Design Results for ephb1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 2 (Pair 1)
Forward (374,21)CGATGGCCCTGGATTATCTACAmplicon SizecDNA: 90 bpgenomic: 130,216
Reverse (463,20)CAGTAGCCGTTCTGGTGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.447 kcal/mol in 3' area
Forward Dimers-2.544 kcal/mol
Reverse Loops0.715 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.362 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceCGATGGCCCTGGATTATCTACTACTGCTCCTCCTGGCATCCGCAGTGGCTGCGATGGAAG
AAACGTTAATGGACACCAGAACGGCTACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)90374 - 463
Exon 1 To Exon 2 (Pair 2)
Forward (373,21)GCGATGGCCCTGGATTATCTAAmplicon SizecDNA: 94 bpgenomic: 130,220
Reverse (466,20)CTGCAGTAGCCGTTCTGGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.253 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops0.268 kcal/mol
Reverse Dimers-2.418 kcal/mol
Forward-Reverse Dimers-2.362 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceGCGATGGCCCTGGATTATCTACTACTGCTCCTCCTGGCATCCGCAGTGGCTGCGATGGAA
GAAACGTTAATGGACACCAGAACGGCTACTGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)94373 - 466
Exon 1 To Exon 2 (Pair 3)
Forward (385,22)GATTATCTACTACTGCTCCTCCAmplicon SizecDNA: 79 bpgenomic: 130,205
Reverse (463,20)CAGTAGCCGTTCTGGTGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.715 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.192 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceGATTATCTACTACTGCTCCTCCTGGCATCCGCAGTGGCTGCGATGGAAGAAACGTTAATG
GACACCAGAACGGCTACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)79385 - 463
Exon 1 To Exon 2 (Pair 4)
Forward (384,22)GGATTATCTACTACTGCTCCTCAmplicon SizecDNA: 80 bpgenomic: 130,206
Reverse (463,20)CAGTAGCCGTTCTGGTGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.464 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.715 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.192 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceGGATTATCTACTACTGCTCCTCCTGGCATCCGCAGTGGCTGCGATGGAAGAAACGTTAAT
GGACACCAGAACGGCTACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)80384 - 463
Exon 1 To Exon 2 (Pair 5)
Forward (374,21)CGATGGCCCTGGATTATCTACAmplicon SizecDNA: 93 bpgenomic: 130,219
Reverse (466,20)CTGCAGTAGCCGTTCTGGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.447 kcal/mol in 3' area
Forward Dimers-2.544 kcal/mol
Reverse Loops0.268 kcal/mol
Reverse Dimers-2.418 kcal/mol
Forward-Reverse Dimers-2.362 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceCGATGGCCCTGGATTATCTACTACTGCTCCTCCTGGCATCCGCAGTGGCTGCGATGGAAG
AAACGTTAATGGACACCAGAACGGCTACTGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)93374 - 466
Exon 1 To Exon 2 (Pair 6)
Forward (373,21)GCGATGGCCCTGGATTATCTAAmplicon SizecDNA: 92 bpgenomic: 130,218
Reverse (464,20)GCAGTAGCCGTTCTGGTGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.253 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops0.538 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.362 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceGCGATGGCCCTGGATTATCTACTACTGCTCCTCCTGGCATCCGCAGTGGCTGCGATGGAA
GAAACGTTAATGGACACCAGAACGGCTACTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)92373 - 464
Exon 1 To Exon 2 (Pair 7)
Forward (374,21)CGATGGCCCTGGATTATCTACAmplicon SizecDNA: 91 bpgenomic: 130,217
Reverse (464,20)GCAGTAGCCGTTCTGGTGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.447 kcal/mol in 3' area
Forward Dimers-2.544 kcal/mol
Reverse Loops0.538 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.362 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceCGATGGCCCTGGATTATCTACTACTGCTCCTCCTGGCATCCGCAGTGGCTGCGATGGAAG
AAACGTTAATGGACACCAGAACGGCTACTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)91374 - 464
Exon 1 To Exon 2 (Pair 8)
Forward (375,22)GATGGCCCTGGATTATCTACTAAmplicon SizecDNA: 92 bpgenomic: 130,218
Reverse (466,20)CTGCAGTAGCCGTTCTGGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.447 kcal/mol in 3' area
Forward Dimers-2.544 kcal/mol
Reverse Loops0.268 kcal/mol
Reverse Dimers-2.418 kcal/mol
Forward-Reverse Dimers-2.362 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceGATGGCCCTGGATTATCTACTACTGCTCCTCCTGGCATCCGCAGTGGCTGCGATGGAAGA
AACGTTAATGGACACCAGAACGGCTACTGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)92375 - 466
Exon 1 To Exon 2 (Pair 9)
Forward (375,22)GATGGCCCTGGATTATCTACTAAmplicon SizecDNA: 89 bpgenomic: 130,215
Reverse (463,20)CAGTAGCCGTTCTGGTGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.447 kcal/mol in 3' area
Forward Dimers-2.544 kcal/mol
Reverse Loops0.715 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.362 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceGATGGCCCTGGATTATCTACTACTGCTCCTCCTGGCATCCGCAGTGGCTGCGATGGAAGA
AACGTTAATGGACACCAGAACGGCTACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)89375 - 463
Exon 1 To Exon 2 (Pair 10)
Forward (373,21)GCGATGGCCCTGGATTATCTAAmplicon SizecDNA: 91 bpgenomic: 130,217
Reverse (463,20)CAGTAGCCGTTCTGGTGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.253 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops0.715 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.362 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceGCGATGGCCCTGGATTATCTACTACTGCTCCTCCTGGCATCCGCAGTGGCTGCGATGGAA
GAAACGTTAATGGACACCAGAACGGCTACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)91373 - 463
Exon 1 To Exon 2 (Pair 11)
Forward (387,22)TTATCTACTACTGCTCCTCCTGAmplicon SizecDNA: 77 bpgenomic: 130,203
Reverse (463,20)CAGTAGCCGTTCTGGTGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.649 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.715 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.192 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceTTATCTACTACTGCTCCTCCTGGCATCCGCAGTGGCTGCGATGGAAGAAACGTTAATGGA
CACCAGAACGGCTACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)77387 - 463
Exon 1 To Exon 2 (Pair 12)
Forward (375,22)GATGGCCCTGGATTATCTACTAAmplicon SizecDNA: 90 bpgenomic: 130,216
Reverse (464,20)GCAGTAGCCGTTCTGGTGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.447 kcal/mol in 3' area
Forward Dimers-2.544 kcal/mol
Reverse Loops0.538 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.362 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceGATGGCCCTGGATTATCTACTACTGCTCCTCCTGGCATCCGCAGTGGCTGCGATGGAAGA
AACGTTAATGGACACCAGAACGGCTACTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)90375 - 464
Exon 2 To Exon 3 (Pair 1)
Forward (478,19)ACGGCCAATCCTGCGTCCGAmplicon SizecDNA: 102 bpgenomic: 25,592
Reverse (579,21)CTGGTTGGGCTCGAAGACATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.937 kcal/mol in 3' area
Forward Dimers-2.704 kcal/mol
Reverse Loops0.644 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.057 kcal/mol
Amplicon Folding-1.053 kcal/mol outside primersite
Amplicon SequenceACGGCCAATCCTGCGTCCGGGTGGGAAGAAGTCAGTGGCTACGATGAAAACCTGAACACC
ATCCGCACCTACCAGGTGTGCAATGTCTTCGAGCCCAACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)102478 - 579
Exon 2 To Exon 3 (Pair 2)
Forward (477,19)GACGGCCAATCCTGCGTCCAmplicon SizecDNA: 102 bpgenomic: 25,592
Reverse (578,21)TGGTTGGGCTCGAAGACATTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.374 kcal/mol in 3' area
Forward Dimers-2.704 kcal/mol
Reverse Loops0.644 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.057 kcal/mol
Amplicon Folding-1.053 kcal/mol outside primersite
Amplicon SequenceGACGGCCAATCCTGCGTCCGGGTGGGAAGAAGTCAGTGGCTACGATGAAAACCTGAACAC
CATCCGCACCTACCAGGTGTGCAATGTCTTCGAGCCCAACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)102477 - 578
Exon 2 To Exon 3 (Pair 3)
Forward (477,19)GACGGCCAATCCTGCGTCCAmplicon SizecDNA: 103 bpgenomic: 25,593
Reverse (579,21)CTGGTTGGGCTCGAAGACATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.374 kcal/mol in 3' area
Forward Dimers-2.704 kcal/mol
Reverse Loops0.644 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.057 kcal/mol
Amplicon Folding-1.053 kcal/mol outside primersite
Amplicon SequenceGACGGCCAATCCTGCGTCCGGGTGGGAAGAAGTCAGTGGCTACGATGAAAACCTGAACAC
CATCCGCACCTACCAGGTGTGCAATGTCTTCGAGCCCAACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)103477 - 579
Exon 2 To Exon 3 (Pair 4)
Forward (477,19)GACGGCCAATCCTGCGTCCAmplicon SizecDNA: 104 bpgenomic: 25,594
Reverse (580,21)TCTGGTTGGGCTCGAAGACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.374 kcal/mol in 3' area
Forward Dimers-2.704 kcal/mol
Reverse Loops0.644 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.057 kcal/mol
Amplicon Folding-1.053 kcal/mol outside primersite
Amplicon SequenceGACGGCCAATCCTGCGTCCGGGTGGGAAGAAGTCAGTGGCTACGATGAAAACCTGAACAC
CATCCGCACCTACCAGGTGTGCAATGTCTTCGAGCCCAACCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)104477 - 580
Exon 2 To Exon 3 (Pair 5)
Forward (478,19)ACGGCCAATCCTGCGTCCGAmplicon SizecDNA: 104 bpgenomic: 25,594
Reverse (581,21)TTCTGGTTGGGCTCGAAGACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.937 kcal/mol in 3' area
Forward Dimers-2.704 kcal/mol
Reverse Loops0.644 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.057 kcal/mol
Amplicon Folding-1.053 kcal/mol outside primersite
Amplicon SequenceACGGCCAATCCTGCGTCCGGGTGGGAAGAAGTCAGTGGCTACGATGAAAACCTGAACACC
ATCCGCACCTACCAGGTGTGCAATGTCTTCGAGCCCAACCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)104478 - 581
Exon 2 To Exon 3 (Pair 6)
Forward (477,19)GACGGCCAATCCTGCGTCCAmplicon SizecDNA: 105 bpgenomic: 25,595
Reverse (581,21)TTCTGGTTGGGCTCGAAGACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.374 kcal/mol in 3' area
Forward Dimers-2.704 kcal/mol
Reverse Loops0.644 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.057 kcal/mol
Amplicon Folding-1.053 kcal/mol outside primersite
Amplicon SequenceGACGGCCAATCCTGCGTCCGGGTGGGAAGAAGTCAGTGGCTACGATGAAAACCTGAACAC
CATCCGCACCTACCAGGTGTGCAATGTCTTCGAGCCCAACCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)105477 - 581
Exon 2 To Exon 3 (Pair 7)
Forward (478,19)ACGGCCAATCCTGCGTCCGAmplicon SizecDNA: 103 bpgenomic: 25,593
Reverse (580,21)TCTGGTTGGGCTCGAAGACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.937 kcal/mol in 3' area
Forward Dimers-2.704 kcal/mol
Reverse Loops0.644 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.057 kcal/mol
Amplicon Folding-1.053 kcal/mol outside primersite
Amplicon SequenceACGGCCAATCCTGCGTCCGGGTGGGAAGAAGTCAGTGGCTACGATGAAAACCTGAACACC
ATCCGCACCTACCAGGTGTGCAATGTCTTCGAGCCCAACCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)103478 - 580
Exon 2 To Exon 3 (Pair 8)
Forward (478,19)ACGGCCAATCCTGCGTCCGAmplicon SizecDNA: 101 bpgenomic: 25,591
Reverse (578,21)TGGTTGGGCTCGAAGACATTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.937 kcal/mol in 3' area
Forward Dimers-2.704 kcal/mol
Reverse Loops0.644 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.057 kcal/mol
Amplicon Folding-1.053 kcal/mol outside primersite
Amplicon SequenceACGGCCAATCCTGCGTCCGGGTGGGAAGAAGTCAGTGGCTACGATGAAAACCTGAACACC
ATCCGCACCTACCAGGTGTGCAATGTCTTCGAGCCCAACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)101478 - 578
Exon 5 To Exon 6 (Pair 1)
Forward (1606,20)GGAGTCTCCAGCAAGAGTCCAmplicon SizecDNA: 91 bpgenomic: 21,193
Reverse (1696,20)GCATGATGGGAACGGTGGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.665 kcal/mol in 3' area
Forward Dimers-2.6 kcal/mol
Reverse Loops1.358 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.062 kcal/mol
Amplicon Folding0.501 kcal/mol outside primersite
Amplicon SequenceGGAGTCTCCAGCAAGAGTCCCTTCCCCCCACAGCACGTCTCTGTCAACATCACCACAAAC
CAAGCCGCCCCCTCCACCGTTCCCATCATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)911606 - 1696
Exon 5 To Exon 6 (Pair 2)
Forward (1606,20)GGAGTCTCCAGCAAGAGTCCAmplicon SizecDNA: 94 bpgenomic: 21,196
Reverse (1699,20)GGTGCATGATGGGAACGGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.665 kcal/mol in 3' area
Forward Dimers-2.6 kcal/mol
Reverse Loops1.358 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.062 kcal/mol
Amplicon Folding0.501 kcal/mol outside primersite
Amplicon SequenceGGAGTCTCCAGCAAGAGTCCCTTCCCCCCACAGCACGTCTCTGTCAACATCACCACAAAC
CAAGCCGCCCCCTCCACCGTTCCCATCATGCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)941606 - 1699
Exon 5 To Exon 6 (Pair 3)
Forward (1606,20)GGAGTCTCCAGCAAGAGTCCAmplicon SizecDNA: 93 bpgenomic: 21,195
Reverse (1698,20)GTGCATGATGGGAACGGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.665 kcal/mol in 3' area
Forward Dimers-2.6 kcal/mol
Reverse Loops1.358 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.062 kcal/mol
Amplicon Folding0.501 kcal/mol outside primersite
Amplicon SequenceGGAGTCTCCAGCAAGAGTCCCTTCCCCCCACAGCACGTCTCTGTCAACATCACCACAAAC
CAAGCCGCCCCCTCCACCGTTCCCATCATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)931606 - 1698
Exon 5 To Exon 6 (Pair 4)
Forward (1535,19)CGGAGTGCCGCGTCTCCATAmplicon SizecDNA: 170 bpgenomic: 21,272
Reverse (1704,21)GACTTGGTGCATGATGGGAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.1 kcal/mol
Forward Dimers-2.568 kcal/mol
Reverse Loops1.81 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-0.307 kcal/mol outside primersite
Amplicon SequenceCGGAGTGCCGCGTCTCCATCAGCAGCCTGTGGGCCCACACCCCCTACACCTTTGACATCC
AGGCCATCAATGGAGTCTCCAGCAAGAGTCCCTTCCCCCCACAGCACGTCTCTGTCAACA
TCACCACAAACCAAGCCGCCCCCTCCACCGTTCCCATCATGCACCAAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1701535 - 1704
Exon 5 To Exon 6 (Pair 5)
Forward (1535,19)CGGAGTGCCGCGTCTCCATAmplicon SizecDNA: 172 bpgenomic: 21,274
Reverse (1706,21)CTGACTTGGTGCATGATGGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.1 kcal/mol
Forward Dimers-2.568 kcal/mol
Reverse Loops1.81 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-0.307 kcal/mol outside primersite
Amplicon SequenceCGGAGTGCCGCGTCTCCATCAGCAGCCTGTGGGCCCACACCCCCTACACCTTTGACATCC
AGGCCATCAATGGAGTCTCCAGCAAGAGTCCCTTCCCCCCACAGCACGTCTCTGTCAACA
TCACCACAAACCAAGCCGCCCCCTCCACCGTTCCCATCATGCACCAAGTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1721535 - 1706
Exon 5 To Exon 6 (Pair 6)
Forward (1535,19)CGGAGTGCCGCGTCTCCATAmplicon SizecDNA: 173 bpgenomic: 21,275
Reverse (1707,21)ACTGACTTGGTGCATGATGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.1 kcal/mol
Forward Dimers-2.568 kcal/mol
Reverse Loops1.676 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-0.307 kcal/mol outside primersite
Amplicon SequenceCGGAGTGCCGCGTCTCCATCAGCAGCCTGTGGGCCCACACCCCCTACACCTTTGACATCC
AGGCCATCAATGGAGTCTCCAGCAAGAGTCCCTTCCCCCCACAGCACGTCTCTGTCAACA
TCACCACAAACCAAGCCGCCCCCTCCACCGTTCCCATCATGCACCAAGTCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1731535 - 1707
Exon 5 To Exon 6 (Pair 7)
Forward (1606,20)GGAGTCTCCAGCAAGAGTCCAmplicon SizecDNA: 96 bpgenomic: 21,198
Reverse (1701,21)TTGGTGCATGATGGGAACGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.665 kcal/mol in 3' area
Forward Dimers-2.6 kcal/mol
Reverse Loops1.358 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.062 kcal/mol
Amplicon Folding0.501 kcal/mol outside primersite
Amplicon SequenceGGAGTCTCCAGCAAGAGTCCCTTCCCCCCACAGCACGTCTCTGTCAACATCACCACAAAC
CAAGCCGCCCCCTCCACCGTTCCCATCATGCACCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)961606 - 1701
Exon 6 To Exon 7 (Pair 1)
Forward (1774,23)TATGAGATCCGGTACTATGAGAAAmplicon SizecDNA: 84 bpgenomic: 7,825
Reverse (1857,22)ATCAATCCTTGCTGTGTTGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-2.298 kcal/mol
Reverse Loops1.549 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.192 kcal/mol outside primersite
Amplicon SequenceTATGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGGAGT
CAGACCAACACAGCAAGGATTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)841774 - 1857
Exon 6 To Exon 7 (Pair 2)
Forward (1776,22)TGAGATCCGGTACTATGAGAAGAmplicon SizecDNA: 119 bpgenomic: 7,860
Reverse (1894,22)GCACCTGTACCACATATACCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-2.298 kcal/mol
Reverse Loops1.777 kcal/mol
Reverse Dimers-0.349 kcal/mol
Forward-Reverse Dimers-1.948 kcal/mol
Amplicon Folding-2.959 kcal/mol outside primersite
Amplicon SequenceTGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGGAGTCA
GACCAACACAGCAAGGATTGATGGGCTGCGGCCTGGCATGGTATATGTGGTACAGGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1191776 - 1894
Exon 6 To Exon 7 (Pair 3)
Forward (1773,22)CTATGAGATCCGGTACTATGAGAmplicon SizecDNA: 84 bpgenomic: 7,825
Reverse (1856,22)TCAATCCTTGCTGTGTTGGTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.086 kcal/mol
Forward Dimers-2.298 kcal/mol
Reverse Loops1.549 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.192 kcal/mol outside primersite
Amplicon SequenceCTATGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGGAG
TCAGACCAACACAGCAAGGATTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)841773 - 1856
Exon 6 To Exon 7 (Pair 4)
Forward (1773,22)CTATGAGATCCGGTACTATGAGAmplicon SizecDNA: 122 bpgenomic: 7,863
Reverse (1894,22)GCACCTGTACCACATATACCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.086 kcal/mol
Forward Dimers-2.298 kcal/mol
Reverse Loops1.777 kcal/mol
Reverse Dimers-0.349 kcal/mol
Forward-Reverse Dimers-1.948 kcal/mol
Amplicon Folding-2.959 kcal/mol outside primersite
Amplicon SequenceCTATGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGGAG
TCAGACCAACACAGCAAGGATTGATGGGCTGCGGCCTGGCATGGTATATGTGGTACAGGT
GC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1221773 - 1894
Exon 6 To Exon 7 (Pair 5)
Forward (1771,22)GACTATGAGATCCGGTACTATGAmplicon SizecDNA: 87 bpgenomic: 7,828
Reverse (1857,22)ATCAATCCTTGCTGTGTTGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-2.298 kcal/mol
Reverse Loops1.549 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.192 kcal/mol outside primersite
Amplicon SequenceGACTATGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGG
AGTCAGACCAACACAGCAAGGATTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)871771 - 1857
Exon 6 To Exon 7 (Pair 6)
Forward (1774,23)TATGAGATCCGGTACTATGAGAAAmplicon SizecDNA: 83 bpgenomic: 7,824
Reverse (1856,22)TCAATCCTTGCTGTGTTGGTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-2.298 kcal/mol
Reverse Loops1.549 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.192 kcal/mol outside primersite
Amplicon SequenceTATGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGGAGT
CAGACCAACACAGCAAGGATTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)831774 - 1856
Exon 6 To Exon 7 (Pair 7)
Forward (1776,22)TGAGATCCGGTACTATGAGAAGAmplicon SizecDNA: 123 bpgenomic: 7,864
Reverse (1898,21)GCACGCACCTGTACCACATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-2.298 kcal/mol
Reverse Loops1.481 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.948 kcal/mol
Amplicon Folding-2.959 kcal/mol outside primersite
Amplicon SequenceTGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGGAGTCA
GACCAACACAGCAAGGATTGATGGGCTGCGGCCTGGCATGGTATATGTGGTACAGGTGCG
TGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1231776 - 1898
Exon 6 To Exon 7 (Pair 8)
Forward (1776,22)TGAGATCCGGTACTATGAGAAGAmplicon SizecDNA: 82 bpgenomic: 7,823
Reverse (1857,22)ATCAATCCTTGCTGTGTTGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-2.298 kcal/mol
Reverse Loops1.549 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.192 kcal/mol outside primersite
Amplicon SequenceTGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGGAGTCA
GACCAACACAGCAAGGATTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)821776 - 1857
Exon 6 To Exon 7 (Pair 9)
Forward (1776,22)TGAGATCCGGTACTATGAGAAGAmplicon SizecDNA: 81 bpgenomic: 7,822
Reverse (1856,22)TCAATCCTTGCTGTGTTGGTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-2.298 kcal/mol
Reverse Loops1.549 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.192 kcal/mol outside primersite
Amplicon SequenceTGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGGAGTCA
GACCAACACAGCAAGGATTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)811776 - 1856
Exon 6 To Exon 7 (Pair 10)
Forward (1776,22)TGAGATCCGGTACTATGAGAAGAmplicon SizecDNA: 120 bpgenomic: 7,861
Reverse (1895,21)CGCACCTGTACCACATATACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-2.298 kcal/mol
Reverse Loops1.777 kcal/mol
Reverse Dimers-0.349 kcal/mol
Forward-Reverse Dimers-1.948 kcal/mol
Amplicon Folding-2.959 kcal/mol outside primersite
Amplicon SequenceTGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGGAGTCA
GACCAACACAGCAAGGATTGATGGGCTGCGGCCTGGCATGGTATATGTGGTACAGGTGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1201776 - 1895
Exon 6 To Exon 7 (Pair 11)
Forward (1774,23)TATGAGATCCGGTACTATGAGAAAmplicon SizecDNA: 121 bpgenomic: 7,862
Reverse (1894,22)GCACCTGTACCACATATACCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-2.298 kcal/mol
Reverse Loops1.777 kcal/mol
Reverse Dimers-0.349 kcal/mol
Forward-Reverse Dimers-1.948 kcal/mol
Amplicon Folding-2.959 kcal/mol outside primersite
Amplicon SequenceTATGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGGAGT
CAGACCAACACAGCAAGGATTGATGGGCTGCGGCCTGGCATGGTATATGTGGTACAGGTG
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1211774 - 1894
Exon 6 To Exon 7 (Pair 12)
Forward (1773,22)CTATGAGATCCGGTACTATGAGAmplicon SizecDNA: 85 bpgenomic: 7,826
Reverse (1857,22)ATCAATCCTTGCTGTGTTGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.086 kcal/mol
Forward Dimers-2.298 kcal/mol
Reverse Loops1.549 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.192 kcal/mol outside primersite
Amplicon SequenceCTATGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGGAG
TCAGACCAACACAGCAAGGATTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)851773 - 1857
Exon 6 To Exon 7 (Pair 13)
Forward (1774,23)TATGAGATCCGGTACTATGAGAAAmplicon SizecDNA: 125 bpgenomic: 7,866
Reverse (1898,21)GCACGCACCTGTACCACATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-2.298 kcal/mol
Reverse Loops1.481 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.948 kcal/mol
Amplicon Folding-2.959 kcal/mol outside primersite
Amplicon SequenceTATGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGGAGT
CAGACCAACACAGCAAGGATTGATGGGCTGCGGCCTGGCATGGTATATGTGGTACAGGTG
CGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1251774 - 1898
Exon 6 To Exon 7 (Pair 14)
Forward (1771,22)GACTATGAGATCCGGTACTATGAmplicon SizecDNA: 86 bpgenomic: 7,827
Reverse (1856,22)TCAATCCTTGCTGTGTTGGTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-2.298 kcal/mol
Reverse Loops1.549 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.192 kcal/mol outside primersite
Amplicon SequenceGACTATGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGG
AGTCAGACCAACACAGCAAGGATTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)861771 - 1856
Exon 6 To Exon 7 (Pair 15)
Forward (1773,22)CTATGAGATCCGGTACTATGAGAmplicon SizecDNA: 126 bpgenomic: 7,867
Reverse (1898,21)GCACGCACCTGTACCACATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.086 kcal/mol
Forward Dimers-2.298 kcal/mol
Reverse Loops1.481 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.948 kcal/mol
Amplicon Folding-2.959 kcal/mol outside primersite
Amplicon SequenceCTATGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGGAG
TCAGACCAACACAGCAAGGATTGATGGGCTGCGGCCTGGCATGGTATATGTGGTACAGGT
GCGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1261773 - 1898
Exon 6 To Exon 7 (Pair 16)
Forward (1773,22)CTATGAGATCCGGTACTATGAGAmplicon SizecDNA: 123 bpgenomic: 7,864
Reverse (1895,21)CGCACCTGTACCACATATACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.086 kcal/mol
Forward Dimers-2.298 kcal/mol
Reverse Loops1.777 kcal/mol
Reverse Dimers-0.349 kcal/mol
Forward-Reverse Dimers-1.948 kcal/mol
Amplicon Folding-2.959 kcal/mol outside primersite
Amplicon SequenceCTATGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGGAG
TCAGACCAACACAGCAAGGATTGATGGGCTGCGGCCTGGCATGGTATATGTGGTACAGGT
GCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1231773 - 1895
Exon 6 To Exon 7 (Pair 17)
Forward (1774,23)TATGAGATCCGGTACTATGAGAAAmplicon SizecDNA: 122 bpgenomic: 7,863
Reverse (1895,21)CGCACCTGTACCACATATACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-2.298 kcal/mol
Reverse Loops1.777 kcal/mol
Reverse Dimers-0.349 kcal/mol
Forward-Reverse Dimers-1.948 kcal/mol
Amplicon Folding-2.959 kcal/mol outside primersite
Amplicon SequenceTATGAGATCCGGTACTATGAGAAGGAACACAATGAGTTCAACTCCTCCATGGCCAGGAGT
CAGACCAACACAGCAAGGATTGATGGGCTGCGGCCTGGCATGGTATATGTGGTACAGGTG
CG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1221774 - 1895
Exon 8 To Exon 11 (Pair 1)
Forward (2021,20)GGGTCGTGTTCGTTGTGTCCAmplicon SizecDNA: 299 bpgenomic: 26,610
Reverse (2319,21)CACGTAGATTTCCCTCTTGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGGGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTT
ATAGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCC
CAGGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGG
AGTTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGG
AGTTTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2992021 - 2319
Exon 8 To Exon 11 (Pair 2)
Forward (2023,21)GTCGTGTTCGTTGTGTCCTTGAmplicon SizecDNA: 259 bpgenomic: 26,570
Reverse (2281,22)CCTTGTACACTTCTCCAAACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.621 kcal/mol in 3' area
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-1.824 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTAT
AGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCA
GGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAG
TTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAG
TTTGGAGAAGTGTACAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2592023 - 2281
Exon 8 To Exon 10 (Pair 1)
Forward (2022,21)GGTCGTGTTCGTTGTGTCCTTAmplicon SizecDNA: 196 bpgenomic: 13,914
Reverse (2217,21)AATCTCCTTGGCAAACTCCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.061 kcal/mol in 3' area
Reverse Dimers-1.823 kcal/mol
Forward-Reverse Dimers-0.816 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTA
TAGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCC
AGGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGA
GTTTGCCAAGGAGATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1962022 - 2217
Exon 8 To Exon 10 (Pair 2)
Forward (2025,21)CGTGTTCGTTGTGTCCTTGGTAmplicon SizecDNA: 173 bpgenomic: 13,891
Reverse (2197,20)GGACAGCTTCGTTGGGATCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.716 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.528 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.019 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATAG
CAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGG
GATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1732025 - 2197
Exon 8 To Exon 11 (Pair 3)
Forward (2024,21)TCGTGTTCGTTGTGTCCTTGGAmplicon SizecDNA: 256 bpgenomic: 26,567
Reverse (2279,22)TTGTACACTTCTCCAAACTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.621 kcal/mol
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-1.824 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATA
GCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAG
GGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGT
TTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGT
TTGGAGAAGTGTACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2562024 - 2279
Exon 8 To Exon 11 (Pair 4)
Forward (2022,21)GGTCGTGTTCGTTGTGTCCTTAmplicon SizecDNA: 301 bpgenomic: 26,612
Reverse (2322,21)GGCCACGTAGATTTCCCTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.748 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTA
TAGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCC
AGGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGA
GTTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGA
GTTTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGGC
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)3012022 - 2322
Exon 8 To Exon 11 (Pair 5)
Forward (2025,21)CGTGTTCGTTGTGTCCTTGGTAmplicon SizecDNA: 256 bpgenomic: 26,567
Reverse (2280,22)CTTGTACACTTCTCCAAACTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.716 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.621 kcal/mol in 3' area
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-1.824 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATAG
CAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGG
GATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTT
TGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTT
TGGAGAAGTGTACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2562025 - 2280
Exon 8 To Exon 11 (Pair 6)
Forward (2024,21)TCGTGTTCGTTGTGTCCTTGGAmplicon SizecDNA: 259 bpgenomic: 26,570
Reverse (2282,22)CCCTTGTACACTTCTCCAAACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.621 kcal/mol in 3' area
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-1.824 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATA
GCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAG
GGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGT
TTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGT
TTGGAGAAGTGTACAAGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2592024 - 2282
Exon 8 To Exon 11 (Pair 7)
Forward (2025,21)CGTGTTCGTTGTGTCCTTGGTAmplicon SizecDNA: 296 bpgenomic: 26,607
Reverse (2320,21)CCACGTAGATTTCCCTCTTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.716 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATAG
CAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGG
GATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTT
TGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTT
TGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2962025 - 2320
Exon 8 To Exon 10 (Pair 3)
Forward (2024,21)TCGTGTTCGTTGTGTCCTTGGAmplicon SizecDNA: 194 bpgenomic: 13,912
Reverse (2217,21)AATCTCCTTGGCAAACTCCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.061 kcal/mol in 3' area
Reverse Dimers-1.823 kcal/mol
Forward-Reverse Dimers-0.816 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATA
GCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAG
GGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGT
TTGCCAAGGAGATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1942024 - 2217
Exon 8 To Exon 11 (Pair 8)
Forward (2024,21)TCGTGTTCGTTGTGTCCTTGGAmplicon SizecDNA: 296 bpgenomic: 26,607
Reverse (2319,21)CACGTAGATTTCCCTCTTGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATA
GCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAG
GGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGT
TTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGT
TTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2962024 - 2319
Exon 8 To Exon 11 (Pair 9)
Forward (2025,21)CGTGTTCGTTGTGTCCTTGGTAmplicon SizecDNA: 298 bpgenomic: 26,609
Reverse (2322,21)GGCCACGTAGATTTCCCTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.716 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATAG
CAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGG
GATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTT
TGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTT
TGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2982025 - 2322
Exon 8 To Exon 11 (Pair 10)
Forward (2023,21)GTCGTGTTCGTTGTGTCCTTGAmplicon SizecDNA: 300 bpgenomic: 26,611
Reverse (2322,21)GGCCACGTAGATTTCCCTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.748 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTAT
AGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCA
GGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAG
TTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAG
TTTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)3002023 - 2322
Exon 8 To Exon 10 (Pair 4)
Forward (2025,21)CGTGTTCGTTGTGTCCTTGGTAmplicon SizecDNA: 174 bpgenomic: 13,892
Reverse (2198,20)CGGACAGCTTCGTTGGGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.716 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.528 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.067 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATAG
CAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGG
GATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1742025 - 2198
Exon 8 To Exon 11 (Pair 11)
Forward (2025,21)CGTGTTCGTTGTGTCCTTGGTAmplicon SizecDNA: 257 bpgenomic: 26,568
Reverse (2281,22)CCTTGTACACTTCTCCAAACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.716 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.621 kcal/mol in 3' area
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-1.824 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATAG
CAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGG
GATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTT
TGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTT
TGGAGAAGTGTACAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2572025 - 2281
Exon 8 To Exon 11 (Pair 12)
Forward (2021,20)GGGTCGTGTTCGTTGTGTCCAmplicon SizecDNA: 297 bpgenomic: 26,608
Reverse (2317,21)CGTAGATTTCCCTCTTGCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.073 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGGGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTT
ATAGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCC
CAGGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGG
AGTTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGG
AGTTTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2972021 - 2317
Exon 8 To Exon 11 (Pair 13)
Forward (2024,21)TCGTGTTCGTTGTGTCCTTGGAmplicon SizecDNA: 298 bpgenomic: 26,609
Reverse (2321,21)GCCACGTAGATTTCCCTCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.748 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATA
GCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAG
GGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGT
TTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGT
TTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2982024 - 2321
Exon 8 To Exon 11 (Pair 14)
Forward (2023,21)GTCGTGTTCGTTGTGTCCTTGAmplicon SizecDNA: 257 bpgenomic: 26,568
Reverse (2279,22)TTGTACACTTCTCCAAACTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.621 kcal/mol
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-1.824 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTAT
AGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCA
GGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAG
TTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAG
TTTGGAGAAGTGTACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2572023 - 2279
Exon 8 To Exon 11 (Pair 15)
Forward (2023,21)GTCGTGTTCGTTGTGTCCTTGAmplicon SizecDNA: 298 bpgenomic: 26,609
Reverse (2320,21)CCACGTAGATTTCCCTCTTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.748 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTAT
AGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCA
GGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAG
TTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAG
TTTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2982023 - 2320
Exon 8 To Exon 11 (Pair 16)
Forward (2022,21)GGTCGTGTTCGTTGTGTCCTTAmplicon SizecDNA: 299 bpgenomic: 26,610
Reverse (2320,21)CCACGTAGATTTCCCTCTTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.748 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTA
TAGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCC
AGGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGA
GTTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGA
GTTTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2992022 - 2320
Exon 8 To Exon 11 (Pair 17)
Forward (2023,21)GTCGTGTTCGTTGTGTCCTTGAmplicon SizecDNA: 299 bpgenomic: 26,610
Reverse (2321,21)GCCACGTAGATTTCCCTCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.748 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTAT
AGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCA
GGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAG
TTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAG
TTTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2992023 - 2321
Exon 8 To Exon 11 (Pair 18)
Forward (2023,21)GTCGTGTTCGTTGTGTCCTTGAmplicon SizecDNA: 258 bpgenomic: 26,569
Reverse (2280,22)CTTGTACACTTCTCCAAACTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.621 kcal/mol in 3' area
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-1.824 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTAT
AGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCA
GGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAG
TTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAG
TTTGGAGAAGTGTACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2582023 - 2280
Exon 8 To Exon 11 (Pair 19)
Forward (2024,21)TCGTGTTCGTTGTGTCCTTGGAmplicon SizecDNA: 258 bpgenomic: 26,569
Reverse (2281,22)CCTTGTACACTTCTCCAAACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.621 kcal/mol in 3' area
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-1.824 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATA
GCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAG
GGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGT
TTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGT
TTGGAGAAGTGTACAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2582024 - 2281
Exon 8 To Exon 10 (Pair 5)
Forward (2023,21)GTCGTGTTCGTTGTGTCCTTGAmplicon SizecDNA: 195 bpgenomic: 13,913
Reverse (2217,21)AATCTCCTTGGCAAACTCCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.061 kcal/mol in 3' area
Reverse Dimers-1.823 kcal/mol
Forward-Reverse Dimers-0.816 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTAT
AGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCA
GGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAG
TTTGCCAAGGAGATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1952023 - 2217
Exon 8 To Exon 11 (Pair 20)
Forward (2023,21)GTCGTGTTCGTTGTGTCCTTGAmplicon SizecDNA: 297 bpgenomic: 26,608
Reverse (2319,21)CACGTAGATTTCCCTCTTGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTAT
AGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCA
GGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAG
TTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAG
TTTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2972023 - 2319
Exon 8 To Exon 11 (Pair 21)
Forward (2023,21)GTCGTGTTCGTTGTGTCCTTGAmplicon SizecDNA: 260 bpgenomic: 26,571
Reverse (2282,22)CCCTTGTACACTTCTCCAAACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.621 kcal/mol in 3' area
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-1.824 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTAT
AGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCA
GGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAG
TTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAG
TTTGGAGAAGTGTACAAGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2602023 - 2282
Exon 8 To Exon 11 (Pair 22)
Forward (2025,21)CGTGTTCGTTGTGTCCTTGGTAmplicon SizecDNA: 297 bpgenomic: 26,608
Reverse (2321,21)GCCACGTAGATTTCCCTCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.716 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATAG
CAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGG
GATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTT
TGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTT
TGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2972025 - 2321
Exon 8 To Exon 11 (Pair 23)
Forward (2021,20)GGGTCGTGTTCGTTGTGTCCAmplicon SizecDNA: 301 bpgenomic: 26,612
Reverse (2321,21)GCCACGTAGATTTCCCTCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.748 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGGGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTT
ATAGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCC
CAGGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGG
AGTTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGG
AGTTTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGG
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)3012021 - 2321
Exon 8 To Exon 11 (Pair 24)
Forward (2024,21)TCGTGTTCGTTGTGTCCTTGGAmplicon SizecDNA: 297 bpgenomic: 26,608
Reverse (2320,21)CCACGTAGATTTCCCTCTTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.748 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATA
GCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAG
GGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGT
TTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGT
TTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2972024 - 2320
Exon 8 To Exon 10 (Pair 6)
Forward (2025,21)CGTGTTCGTTGTGTCCTTGGTAmplicon SizecDNA: 193 bpgenomic: 13,911
Reverse (2217,21)AATCTCCTTGGCAAACTCCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.716 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.061 kcal/mol in 3' area
Reverse Dimers-1.823 kcal/mol
Forward-Reverse Dimers-0.816 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATAG
CAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGG
GATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTT
TGCCAAGGAGATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1932025 - 2217
Exon 8 To Exon 11 (Pair 25)
Forward (2025,21)CGTGTTCGTTGTGTCCTTGGTAmplicon SizecDNA: 258 bpgenomic: 26,569
Reverse (2282,22)CCCTTGTACACTTCTCCAAACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.716 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.621 kcal/mol in 3' area
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-1.824 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATAG
CAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGG
GATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTT
TGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTT
TGGAGAAGTGTACAAGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2582025 - 2282
Exon 8 To Exon 11 (Pair 26)
Forward (2021,20)GGGTCGTGTTCGTTGTGTCCAmplicon SizecDNA: 300 bpgenomic: 26,611
Reverse (2320,21)CCACGTAGATTTCCCTCTTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.748 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGGGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTT
ATAGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCC
CAGGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGG
AGTTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGG
AGTTTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)3002021 - 2320
Exon 8 To Exon 11 (Pair 27)
Forward (2025,21)CGTGTTCGTTGTGTCCTTGGTAmplicon SizecDNA: 295 bpgenomic: 26,606
Reverse (2319,21)CACGTAGATTTCCCTCTTGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.716 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATAG
CAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGG
GATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTT
TGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTT
TGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2952025 - 2319
Exon 8 To Exon 11 (Pair 28)
Forward (2022,21)GGTCGTGTTCGTTGTGTCCTTAmplicon SizecDNA: 298 bpgenomic: 26,609
Reverse (2319,21)CACGTAGATTTCCCTCTTGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTA
TAGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCC
AGGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGA
GTTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGA
GTTTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2982022 - 2319
Exon 8 To Exon 11 (Pair 29)
Forward (2024,21)TCGTGTTCGTTGTGTCCTTGGAmplicon SizecDNA: 299 bpgenomic: 26,610
Reverse (2322,21)GGCCACGTAGATTTCCCTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.748 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATA
GCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAG
GGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGT
TTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGT
TTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2992024 - 2322
Exon 8 To Exon 11 (Pair 30)
Forward (2024,21)TCGTGTTCGTTGTGTCCTTGGAmplicon SizecDNA: 257 bpgenomic: 26,568
Reverse (2280,22)CTTGTACACTTCTCCAAACTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.621 kcal/mol in 3' area
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-1.824 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATA
GCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAG
GGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGT
TTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGT
TTGGAGAAGTGTACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2572024 - 2280
Exon 8 To Exon 11 (Pair 31)
Forward (2025,21)CGTGTTCGTTGTGTCCTTGGTAmplicon SizecDNA: 255 bpgenomic: 26,566
Reverse (2279,22)TTGTACACTTCTCCAAACTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.716 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops2.621 kcal/mol
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-1.824 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTATAG
CAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGG
GATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTT
TGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTT
TGGAGAAGTGTACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2552025 - 2279
Exon 8 To Exon 11 (Pair 32)
Forward (2022,21)GGTCGTGTTCGTTGTGTCCTTAmplicon SizecDNA: 300 bpgenomic: 26,611
Reverse (2321,21)GCCACGTAGATTTCCCTCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers0.382 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.748 kcal/mol
Amplicon Folding-0.674 kcal/mol outside primersite
Amplicon SequenceGGTCGTGTTCGTTGTGTCCTTGGTGGCCATCTCTATCGTCTGTAGCAGGAAACGGGCTTA
TAGCAAAGAGGCTGTGTACAGCGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCC
AGGGATGAAGATCTACATTGACCCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGA
GTTTGCCAAGGAGATTGATGTATCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGA
GTTTGGAGAAGTGTACAAGGGGCGTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)3002022 - 2321
Exon 9 To Exon 11 (Pair 1)
Forward (2104,22)GATAAGCTCCAGCATTACAGCAAmplicon SizecDNA: 197 bpgenomic: 25,643
Reverse (2300,20)CCTGGCAGTTTCAAACGCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.543 kcal/mol in 3' area
Reverse Dimers-2.561 kcal/mol
Forward-Reverse Dimers-1.825 kcal/mol
Amplicon Folding0.071 kcal/mol inside primersite
Amplicon SequenceGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGAC
CCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTGATGTA
TCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTTTGGAGAAGTGTACAAGGGG
CGTTTGAAACTGCCAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1972104 - 2300
Exon 9 To Exon 10 (Pair 1)
Forward (2108,21)AGCTCCAGCATTACAGCACAGAmplicon SizecDNA: 121 bpgenomic: 12,974
Reverse (2228,23)AAAGATACATCAATCTCCTTGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-1.83 kcal/mol
Reverse Loops0.827 kcal/mol
Reverse Dimers-1.568 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding0.31 kcal/mol outside primersite
Amplicon SequenceAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGACCCCT
TCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTGATGTATCTT
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1212108 - 2228
Exon 9 To Exon 10 (Pair 2)
Forward (2106,22)TAAGCTCCAGCATTACAGCACAAmplicon SizecDNA: 113 bpgenomic: 12,966
Reverse (2218,21)CAATCTCCTTGGCAAACTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.939 kcal/mol
Reverse Dimers-1.823 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding0.31 kcal/mol outside primersite
Amplicon SequenceTAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGACCC
CTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1132106 - 2218
Exon 9 To Exon 11 (Pair 2)
Forward (2105,22)ATAAGCTCCAGCATTACAGCACAmplicon SizecDNA: 178 bpgenomic: 25,624
Reverse (2282,22)CCCTTGTACACTTCTCCAAACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.621 kcal/mol in 3' area
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-0.708 kcal/mol
Amplicon Folding0.31 kcal/mol outside primersite
Amplicon SequenceATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGACC
CCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTGATGTAT
CTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTTTGGAGAAGTGTACAAGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1782105 - 2282
Exon 9 To Exon 10 (Pair 3)
Forward (2106,22)TAAGCTCCAGCATTACAGCACAAmplicon SizecDNA: 122 bpgenomic: 12,975
Reverse (2227,23)AAGATACATCAATCTCCTTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.827 kcal/mol
Reverse Dimers-1.568 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding0.31 kcal/mol outside primersite
Amplicon SequenceTAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGACCC
CTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTGATGTATC
TT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1222106 - 2227
Exon 9 To Exon 11 (Pair 3)
Forward (2105,22)ATAAGCTCCAGCATTACAGCACAmplicon SizecDNA: 176 bpgenomic: 25,622
Reverse (2280,22)CTTGTACACTTCTCCAAACTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.621 kcal/mol in 3' area
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-0.708 kcal/mol
Amplicon Folding0.31 kcal/mol outside primersite
Amplicon SequenceATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGACC
CCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTGATGTAT
CTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTTTGGAGAAGTGTACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1762105 - 2280
Exon 9 To Exon 10 (Pair 4)
Forward (2105,22)ATAAGCTCCAGCATTACAGCACAmplicon SizecDNA: 123 bpgenomic: 12,976
Reverse (2227,23)AAGATACATCAATCTCCTTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.827 kcal/mol
Reverse Dimers-1.568 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding0.31 kcal/mol outside primersite
Amplicon SequenceATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGACC
CCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTGATGTAT
CTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1232105 - 2227
Exon 9 To Exon 11 (Pair 4)
Forward (2108,21)AGCTCCAGCATTACAGCACAGAmplicon SizecDNA: 215 bpgenomic: 25,661
Reverse (2322,21)GGCCACGTAGATTTCCCTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-1.83 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-0.704 kcal/mol
Amplicon Folding0.071 kcal/mol outside primersite
Amplicon SequenceAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGACCCCT
TCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTGATGTATCTT
TTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTTTGGAGAAGTGTACAAGGGGCGTT
TGAAACTGCCAGGCAAGAGGGAAATCTACGTGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2152108 - 2322
Exon 9 To Exon 11 (Pair 5)
Forward (2105,22)ATAAGCTCCAGCATTACAGCACAmplicon SizecDNA: 218 bpgenomic: 25,664
Reverse (2322,21)GGCCACGTAGATTTCCCTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-0.882 kcal/mol
Amplicon Folding0.071 kcal/mol outside primersite
Amplicon SequenceATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGACC
CCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTGATGTAT
CTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTTTGGAGAAGTGTACAAGGGGC
GTTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2182105 - 2322
Exon 9 To Exon 10 (Pair 5)
Forward (2108,21)AGCTCCAGCATTACAGCACAGAmplicon SizecDNA: 111 bpgenomic: 12,964
Reverse (2218,21)CAATCTCCTTGGCAAACTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-1.83 kcal/mol
Reverse Loops1.939 kcal/mol
Reverse Dimers-1.823 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding0.31 kcal/mol outside primersite
Amplicon SequenceAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGACCCCT
TCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1112108 - 2218
Exon 9 To Exon 11 (Pair 6)
Forward (2106,22)TAAGCTCCAGCATTACAGCACAAmplicon SizecDNA: 195 bpgenomic: 25,641
Reverse (2300,20)CCTGGCAGTTTCAAACGCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.543 kcal/mol in 3' area
Reverse Dimers-2.561 kcal/mol
Forward-Reverse Dimers-1.825 kcal/mol
Amplicon Folding0.071 kcal/mol inside primersite
Amplicon SequenceTAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGACCC
CTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTGATGTATC
TTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTTTGGAGAAGTGTACAAGGGGCG
TTTGAAACTGCCAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1952106 - 2300
Exon 9 To Exon 11 (Pair 7)
Forward (2105,22)ATAAGCTCCAGCATTACAGCACAmplicon SizecDNA: 177 bpgenomic: 25,623
Reverse (2281,22)CCTTGTACACTTCTCCAAACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.621 kcal/mol in 3' area
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-0.708 kcal/mol
Amplicon Folding0.31 kcal/mol outside primersite
Amplicon SequenceATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGACC
CCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTGATGTAT
CTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTTTGGAGAAGTGTACAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1772105 - 2281
Exon 9 To Exon 10 (Pair 6)
Forward (2104,22)GATAAGCTCCAGCATTACAGCAAmplicon SizecDNA: 124 bpgenomic: 12,977
Reverse (2227,23)AAGATACATCAATCTCCTTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.827 kcal/mol
Reverse Dimers-1.568 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding0.31 kcal/mol outside primersite
Amplicon SequenceGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGAC
CCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTGATGTA
TCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1242104 - 2227
Exon 9 To Exon 11 (Pair 8)
Forward (2106,22)TAAGCTCCAGCATTACAGCACAAmplicon SizecDNA: 216 bpgenomic: 25,662
Reverse (2321,21)GCCACGTAGATTTCCCTCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.839 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-0.882 kcal/mol
Amplicon Folding0.071 kcal/mol outside primersite
Amplicon SequenceTAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGACCC
CTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTGATGTATC
TTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTTTGGAGAAGTGTACAAGGGGCG
TTTGAAACTGCCAGGCAAGAGGGAAATCTACGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)2162106 - 2321
Exon 9 To Exon 11 (Pair 9)
Forward (2104,22)GATAAGCTCCAGCATTACAGCAAmplicon SizecDNA: 176 bpgenomic: 25,622
Reverse (2279,22)TTGTACACTTCTCCAAACTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.621 kcal/mol
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-0.708 kcal/mol
Amplicon Folding0.31 kcal/mol outside primersite
Amplicon SequenceGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGAC
CCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTGATGTA
TCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTTTGGAGAAGTGTACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1762104 - 2279
Exon 9 To Exon 10 (Pair 7)
Forward (2104,22)GATAAGCTCCAGCATTACAGCAAmplicon SizecDNA: 115 bpgenomic: 12,968
Reverse (2218,21)CAATCTCCTTGGCAAACTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.939 kcal/mol
Reverse Dimers-1.823 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding0.31 kcal/mol outside primersite
Amplicon SequenceGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGAC
CCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1152104 - 2218
Exon 9 To Exon 10 (Pair 8)
Forward (2108,21)AGCTCCAGCATTACAGCACAGAmplicon SizecDNA: 90 bpgenomic: 12,943
Reverse (2197,20)GGACAGCTTCGTTGGGATCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-1.83 kcal/mol
Reverse Loops1.528 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.759 kcal/mol
Amplicon Folding0.31 kcal/mol outside primersite
Amplicon SequenceAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGACCCCT
TCACTTACGAGGATCCCAACGAAGCTGTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)902108 - 2197
Exon 9 To Exon 11 (Pair 10)
Forward (2104,22)GATAAGCTCCAGCATTACAGCAAmplicon SizecDNA: 177 bpgenomic: 25,623
Reverse (2280,22)CTTGTACACTTCTCCAAACTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.621 kcal/mol in 3' area
Reverse Dimers-1.438 kcal/mol
Forward-Reverse Dimers-0.708 kcal/mol
Amplicon Folding0.31 kcal/mol outside primersite
Amplicon SequenceGATAAGCTCCAGCATTACAGCACAGGCCGAGGCTCCCCAGGGATGAAGATCTACATTGAC
CCCTTCACTTACGAGGATCCCAACGAAGCTGTCCGGGAGTTTGCCAAGGAGATTGATGTA
TCTTTTGTGAAAATTGAAGAGGTCATCGGAGCAGGGGAGTTTGGAGAAGTGTACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004441 (EPHB1)1772104 - 2280
 

See below for some more details.

Program Output:

Loading ...