Design Results for fbn1

(Canis Lupus Familiaris, Broad CanFam3.1/canFam3)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 6 To Exon 7 (Pair 1)
Forward (884,23)AGGCTTCATTCCAAATATCCGTAAmplicon SizecDNA: 100 bpgenomic: 3,483
Reverse (983,24)AACAGTATTAATGCAATTTCCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.663 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops0.994 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.351 kcal/mol
Amplicon Folding-1.782 kcal/mol outside primersite
Amplicon SequenceAGGCTTCATTCCAAATATCCGTACGGGAGCCTGTCAAGATGTGGATGAATGCCAGGCCAT
CCCTGGGCTCTGTCAAGGAGGAAATTGCATTAATACTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)100884 - 983
Exon 6 To Exon 7 (Pair 2)
Forward (884,23)AGGCTTCATTCCAAATATCCGTAAmplicon SizecDNA: 99 bpgenomic: 3,482
Reverse (982,24)ACAGTATTAATGCAATTTCCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.663 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops0.994 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.351 kcal/mol
Amplicon Folding-1.782 kcal/mol outside primersite
Amplicon SequenceAGGCTTCATTCCAAATATCCGTACGGGAGCCTGTCAAGATGTGGATGAATGCCAGGCCAT
CCCTGGGCTCTGTCAAGGAGGAAATTGCATTAATACTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)99884 - 982
Exon 6 To Exon 7 (Pair 3)
Forward (884,23)AGGCTTCATTCCAAATATCCGTAAmplicon SizecDNA: 96 bpgenomic: 3,479
Reverse (979,24)GTATTAATGCAATTTCCTCCTTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.663 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops0.994 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.351 kcal/mol
Amplicon Folding-1.782 kcal/mol outside primersite
Amplicon SequenceAGGCTTCATTCCAAATATCCGTACGGGAGCCTGTCAAGATGTGGATGAATGCCAGGCCAT
CCCTGGGCTCTGTCAAGGAGGAAATTGCATTAATAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)96884 - 979
Exon 6 To Exon 7 (Pair 4)
Forward (884,23)AGGCTTCATTCCAAATATCCGTAAmplicon SizecDNA: 94 bpgenomic: 3,477
Reverse (977,24)ATTAATGCAATTTCCTCCTTGACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.663 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops0.994 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.351 kcal/mol
Amplicon Folding-1.782 kcal/mol outside primersite
Amplicon SequenceAGGCTTCATTCCAAATATCCGTACGGGAGCCTGTCAAGATGTGGATGAATGCCAGGCCAT
CCCTGGGCTCTGTCAAGGAGGAAATTGCATTAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)94884 - 977
Exon 6 To Exon 8 (Pair 1)
Forward (884,23)AGGCTTCATTCCAAATATCCGTAAmplicon SizecDNA: 188 bpgenomic: 10,209
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.663 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.269 kcal/mol
Amplicon Folding-1.958 kcal/mol outside primersite
Amplicon SequenceAGGCTTCATTCCAAATATCCGTACGGGAGCCTGTCAAGATGTGGATGAATGCCAGGCCAT
CCCTGGGCTCTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATG
CCCTGCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAG
TACCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)188884 - 1071
Exon 6 To Exon 7 (Pair 5)
Forward (884,23)AGGCTTCATTCCAAATATCCGTAAmplicon SizecDNA: 95 bpgenomic: 3,478
Reverse (978,24)TATTAATGCAATTTCCTCCTTGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.663 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops0.994 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.351 kcal/mol
Amplicon Folding-1.782 kcal/mol outside primersite
Amplicon SequenceAGGCTTCATTCCAAATATCCGTACGGGAGCCTGTCAAGATGTGGATGAATGCCAGGCCAT
CCCTGGGCTCTGTCAAGGAGGAAATTGCATTAATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)95884 - 978
Exon 6 To Exon 7 (Pair 6)
Forward (884,23)AGGCTTCATTCCAAATATCCGTAAmplicon SizecDNA: 97 bpgenomic: 3,480
Reverse (980,24)AGTATTAATGCAATTTCCTCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.663 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops0.994 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.351 kcal/mol
Amplicon Folding-1.782 kcal/mol outside primersite
Amplicon SequenceAGGCTTCATTCCAAATATCCGTACGGGAGCCTGTCAAGATGTGGATGAATGCCAGGCCAT
CCCTGGGCTCTGTCAAGGAGGAAATTGCATTAATACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)97884 - 980
Exon 6 To Exon 7 (Pair 7)
Forward (884,23)AGGCTTCATTCCAAATATCCGTAAmplicon SizecDNA: 98 bpgenomic: 3,481
Reverse (981,24)CAGTATTAATGCAATTTCCTCCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.663 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops0.994 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.351 kcal/mol
Amplicon Folding-1.782 kcal/mol outside primersite
Amplicon SequenceAGGCTTCATTCCAAATATCCGTACGGGAGCCTGTCAAGATGTGGATGAATGCCAGGCCAT
CCCTGGGCTCTGTCAAGGAGGAAATTGCATTAATACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)98884 - 981
Exon 6 To Exon 8 (Pair 2)
Forward (884,23)AGGCTTCATTCCAAATATCCGTAAmplicon SizecDNA: 190 bpgenomic: 10,211
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.663 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-2.922 kcal/mol
Amplicon Folding-1.958 kcal/mol outside primersite
Amplicon SequenceAGGCTTCATTCCAAATATCCGTACGGGAGCCTGTCAAGATGTGGATGAATGCCAGGCCAT
CCCTGGGCTCTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATG
CCCTGCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAG
TACCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)190884 - 1073
Exon 6 To Exon 8 (Pair 3)
Forward (884,23)AGGCTTCATTCCAAATATCCGTAAmplicon SizecDNA: 189 bpgenomic: 10,210
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.663 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-2.595 kcal/mol
Amplicon Folding-1.958 kcal/mol outside primersite
Amplicon SequenceAGGCTTCATTCCAAATATCCGTACGGGAGCCTGTCAAGATGTGGATGAATGCCAGGCCAT
CCCTGGGCTCTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATG
CCCTGCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAG
TACCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)189884 - 1072
Exon 6 To Exon 7 (Pair 8)
Forward (884,23)AGGCTTCATTCCAAATATCCGTAAmplicon SizecDNA: 92 bpgenomic: 3,475
Reverse (975,23)TAATGCAATTTCCTCCTTGACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.663 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops0.994 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.351 kcal/mol
Amplicon Folding-1.782 kcal/mol outside primersite
Amplicon SequenceAGGCTTCATTCCAAATATCCGTACGGGAGCCTGTCAAGATGTGGATGAATGCCAGGCCAT
CCCTGGGCTCTGTCAAGGAGGAAATTGCATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)92884 - 975
Exon 7 To Exon 8 (Pair 1)
Forward (962,24)AGGAAATTGCATTAATACTGTTGGAmplicon SizecDNA: 110 bpgenomic: 6,748
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATT
TAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)110962 - 1071
Exon 7 To Exon 8 (Pair 2)
Forward (967,24)ATTGCATTAATACTGTTGGGTCTTAmplicon SizecDNA: 107 bpgenomic: 6,745
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.402 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTAATG
AAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)107967 - 1073
Exon 7 To Exon 8 (Pair 3)
Forward (964,24)GAAATTGCATTAATACTGTTGGGTAmplicon SizecDNA: 110 bpgenomic: 6,748
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTA
ATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)110964 - 1073
Exon 7 To Exon 8 (Pair 4)
Forward (966,24)AATTGCATTAATACTGTTGGGTCTAmplicon SizecDNA: 107 bpgenomic: 6,745
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTAAT
GAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)107966 - 1072
Exon 7 To Exon 9 (Pair 1)
Forward (966,24)AATTGCATTAATACTGTTGGGTCTAmplicon SizecDNA: 247 bpgenomic: 12,077
Reverse (1212,22)CATTTGCCAGAGCTGTGTAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.777 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTAAT
GAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGGAATCTGTGAT
GGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCCTGGTTTTTAC
CCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTACACAGCTCTG
GCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)247966 - 1212
Exon 7 To Exon 8 (Pair 5)
Forward (965,24)AAATTGCATTAATACTGTTGGGTCAmplicon SizecDNA: 108 bpgenomic: 6,746
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTAA
TGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)108965 - 1072
Exon 7 To Exon 9 (Pair 2)
Forward (1009,24)CTGGACACAAATTTAATGAAGCATAmplicon SizecDNA: 277 bpgenomic: 12,107
Reverse (1285,20)GACCAGCATCGGCCAACATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.858 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops0.934 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.452 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCA
TTCCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGT
GTCCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGAT
ACTGTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAA
AAATGCAGTGCTGCTGTGATGTTGGCCGATGCTGGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2771009 - 1285
Exon 7 To Exon 9 (Pair 3)
Forward (955,24)GTCAAGGAGGAAATTGCATTAATAAmplicon SizecDNA: 260 bpgenomic: 12,090
Reverse (1214,21)CCCATTTGCCAGAGCTGTGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGAC
ACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTG
GAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTC
CTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTT
ACACAGCTCTGGCAAATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)260955 - 1214
Exon 7 To Exon 8 (Pair 6)
Forward (957,24)CAAGGAGGAAATTGCATTAATACTAmplicon SizecDNA: 115 bpgenomic: 6,753
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACAC
AAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)115957 - 1071
Exon 7 To Exon 9 (Pair 4)
Forward (1010,24)TGGACACAAATTTAATGAAGCATCAmplicon SizecDNA: 268 bpgenomic: 12,098
Reverse (1277,20)TCGGCCAACATCACAGCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.349 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops1.589 kcal/mol in 3' area
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-1.674 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCAT
TCCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTG
TCCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATA
CTGTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAAA
AATGCAGTGCTGCTGTGATGTTGGCCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2681010 - 1277
Exon 7 To Exon 8 (Pair 7)
Forward (947,21)TGGGCTCTGTCAAGGAGGAAAAmplicon SizecDNA: 126 bpgenomic: 6,764
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.88 kcal/mol in 3' area
Forward Dimers-0.348 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceTGGGCTCTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCC
TGCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTAC
CATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)126947 - 1072
Exon 7 To Exon 9 (Pair 5)
Forward (1012,24)GACACAAATTTAATGAAGCATCACAmplicon SizecDNA: 279 bpgenomic: 12,109
Reverse (1290,19)CTGGAGACCAGCATCGGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.18 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops0.571 kcal/mol
Reverse Dimers-1.993 kcal/mol
Forward-Reverse Dimers-1.505 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTC
CTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTC
CTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACT
GTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAAAAA
TGCAGTGCTGCTGTGATGTTGGCCGATGCTGGTCTCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2791012 - 1290
Exon 7 To Exon 8 (Pair 8)
Forward (965,24)AAATTGCATTAATACTGTTGGGTCAmplicon SizecDNA: 107 bpgenomic: 6,745
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTAA
TGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)107965 - 1071
Exon 7 To Exon 8 (Pair 9)
Forward (955,24)GTCAAGGAGGAAATTGCATTAATAAmplicon SizecDNA: 119 bpgenomic: 6,757
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGAC
ACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)119955 - 1073
Exon 7 To Exon 8 (Pair 10)
Forward (962,24)AGGAAATTGCATTAATACTGTTGGAmplicon SizecDNA: 111 bpgenomic: 6,749
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATT
TAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)111962 - 1072
Exon 7 To Exon 8 (Pair 11)
Forward (966,24)AATTGCATTAATACTGTTGGGTCTAmplicon SizecDNA: 106 bpgenomic: 6,744
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTAAT
GAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)106966 - 1071
Exon 7 To Exon 8 (Pair 12)
Forward (959,24)AGGAGGAAATTGCATTAATACTGTAmplicon SizecDNA: 113 bpgenomic: 6,751
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAA
ATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)113959 - 1071
Exon 7 To Exon 8 (Pair 13)
Forward (966,24)AATTGCATTAATACTGTTGGGTCTAmplicon SizecDNA: 108 bpgenomic: 6,746
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTAAT
GAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)108966 - 1073
Exon 7 To Exon 9 (Pair 6)
Forward (1011,24)GGACACAAATTTAATGAAGCATCAAmplicon SizecDNA: 267 bpgenomic: 12,097
Reverse (1277,20)TCGGCCAACATCACAGCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.206 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops1.589 kcal/mol in 3' area
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-1.674 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATT
CCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGT
CCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATAC
TGTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAAAA
ATGCAGTGCTGCTGTGATGTTGGCCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2671011 - 1277
Exon 7 To Exon 8 (Pair 14)
Forward (960,24)GGAGGAAATTGCATTAATACTGTTAmplicon SizecDNA: 114 bpgenomic: 6,752
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAA
TTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)114960 - 1073
Exon 7 To Exon 9 (Pair 7)
Forward (959,24)AGGAGGAAATTGCATTAATACTGTAmplicon SizecDNA: 256 bpgenomic: 12,086
Reverse (1214,21)CCCATTTGCCAGAGCTGTGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAA
ATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGGAAT
CTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCCTGG
TTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTACAC
AGCTCTGGCAAATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)256959 - 1214
Exon 7 To Exon 9 (Pair 8)
Forward (1009,24)CTGGACACAAATTTAATGAAGCATAmplicon SizecDNA: 282 bpgenomic: 12,112
Reverse (1290,19)CTGGAGACCAGCATCGGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.858 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops0.571 kcal/mol
Reverse Dimers-1.993 kcal/mol
Forward-Reverse Dimers-2.452 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCA
TTCCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGT
GTCCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGAT
ACTGTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAA
AAATGCAGTGCTGCTGTGATGTTGGCCGATGCTGGTCTCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2821009 - 1290
Exon 7 To Exon 9 (Pair 9)
Forward (958,24)AAGGAGGAAATTGCATTAATACTGAmplicon SizecDNA: 255 bpgenomic: 12,085
Reverse (1212,22)CATTTGCCAGAGCTGTGTAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.777 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACA
AATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGGAA
TCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCCTG
GTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTACA
CAGCTCTGGCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)255958 - 1212
Exon 7 To Exon 8 (Pair 15)
Forward (957,24)CAAGGAGGAAATTGCATTAATACTAmplicon SizecDNA: 116 bpgenomic: 6,754
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACAC
AAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)116957 - 1072
Exon 7 To Exon 9 (Pair 10)
Forward (954,24)TGTCAAGGAGGAAATTGCATTAATAmplicon SizecDNA: 259 bpgenomic: 12,089
Reverse (1212,22)CATTTGCCAGAGCTGTGTAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.541 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.777 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGA
CACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
GGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCT
CCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGT
TACACAGCTCTGGCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)259954 - 1212
Exon 7 To Exon 8 (Pair 16)
Forward (968,24)TTGCATTAATACTGTTGGGTCTTTAmplicon SizecDNA: 104 bpgenomic: 6,742
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.402 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceTTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTAATGA
AGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)104968 - 1071
Exon 7 To Exon 9 (Pair 11)
Forward (957,24)CAAGGAGGAAATTGCATTAATACTAmplicon SizecDNA: 258 bpgenomic: 12,088
Reverse (1214,21)CCCATTTGCCAGAGCTGTGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACAC
AAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGGA
ATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCCT
GGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTAC
ACAGCTCTGGCAAATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)258957 - 1214
Exon 7 To Exon 8 (Pair 17)
Forward (958,24)AAGGAGGAAATTGCATTAATACTGAmplicon SizecDNA: 116 bpgenomic: 6,754
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACA
AATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)116958 - 1073
Exon 7 To Exon 9 (Pair 12)
Forward (1009,24)CTGGACACAAATTTAATGAAGCATAmplicon SizecDNA: 269 bpgenomic: 12,099
Reverse (1277,20)TCGGCCAACATCACAGCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.858 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops1.589 kcal/mol in 3' area
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-1.674 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCA
TTCCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGT
GTCCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGAT
ACTGTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAA
AAATGCAGTGCTGCTGTGATGTTGGCCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2691009 - 1277
Exon 7 To Exon 8 (Pair 18)
Forward (947,21)TGGGCTCTGTCAAGGAGGAAAAmplicon SizecDNA: 125 bpgenomic: 6,763
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.88 kcal/mol in 3' area
Forward Dimers-0.348 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceTGGGCTCTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCC
TGCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTAC
CATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)125947 - 1071
Exon 7 To Exon 8 (Pair 19)
Forward (956,24)TCAAGGAGGAAATTGCATTAATACAmplicon SizecDNA: 118 bpgenomic: 6,756
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACA
CAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)118956 - 1073
Exon 7 To Exon 9 (Pair 13)
Forward (1009,24)CTGGACACAAATTTAATGAAGCATAmplicon SizecDNA: 283 bpgenomic: 12,113
Reverse (1291,19)CCTGGAGACCAGCATCGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.858 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops0.36 kcal/mol
Reverse Dimers-2.204 kcal/mol
Forward-Reverse Dimers-2.452 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCA
TTCCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGT
GTCCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGAT
ACTGTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAA
AAATGCAGTGCTGCTGTGATGTTGGCCGATGCTGGTCTCCAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2831009 - 1291
Exon 7 To Exon 9 (Pair 14)
Forward (1010,24)TGGACACAAATTTAATGAAGCATCAmplicon SizecDNA: 271 bpgenomic: 12,101
Reverse (1280,20)GCATCGGCCAACATCACAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.349 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops1.261 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-1.674 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCAT
TCCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTG
TCCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATA
CTGTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAAA
AATGCAGTGCTGCTGTGATGTTGGCCGATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2711010 - 1280
Exon 7 To Exon 8 (Pair 20)
Forward (956,24)TCAAGGAGGAAATTGCATTAATACAmplicon SizecDNA: 117 bpgenomic: 6,755
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACA
CAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)117956 - 1072
Exon 7 To Exon 9 (Pair 15)
Forward (1009,24)CTGGACACAAATTTAATGAAGCATAmplicon SizecDNA: 275 bpgenomic: 12,105
Reverse (1283,20)CCAGCATCGGCCAACATCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.858 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops0.934 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-1.909 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCA
TTCCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGT
GTCCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGAT
ACTGTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAA
AAATGCAGTGCTGCTGTGATGTTGGCCGATGCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2751009 - 1283
Exon 7 To Exon 9 (Pair 16)
Forward (964,24)GAAATTGCATTAATACTGTTGGGTAmplicon SizecDNA: 249 bpgenomic: 12,079
Reverse (1212,22)CATTTGCCAGAGCTGTGTAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.777 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTA
ATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGGAATCTGTG
ATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCCTGGTTTTT
ACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTACACAGCTC
TGGCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)249964 - 1212
Exon 7 To Exon 8 (Pair 21)
Forward (960,24)GGAGGAAATTGCATTAATACTGTTAmplicon SizecDNA: 112 bpgenomic: 6,750
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAA
TTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)112960 - 1071
Exon 7 To Exon 8 (Pair 22)
Forward (947,21)TGGGCTCTGTCAAGGAGGAAAAmplicon SizecDNA: 127 bpgenomic: 6,765
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.88 kcal/mol in 3' area
Forward Dimers-0.348 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceTGGGCTCTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCC
TGCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTAC
CATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)127947 - 1073
Exon 7 To Exon 8 (Pair 23)
Forward (961,24)GAGGAAATTGCATTAATACTGTTGAmplicon SizecDNA: 111 bpgenomic: 6,749
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAAT
TTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)111961 - 1071
Exon 7 To Exon 8 (Pair 24)
Forward (965,24)AAATTGCATTAATACTGTTGGGTCAmplicon SizecDNA: 109 bpgenomic: 6,747
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTAA
TGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)109965 - 1073
Exon 7 To Exon 9 (Pair 17)
Forward (968,24)TTGCATTAATACTGTTGGGTCTTTAmplicon SizecDNA: 247 bpgenomic: 12,077
Reverse (1214,21)CCCATTTGCCAGAGCTGTGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.402 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.681 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceTTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTAATGA
AGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGGAATCTGTGATGG
GGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCCTGGTTTTTACCC
CTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTACACAGCTCTGGC
AAATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)247968 - 1214
Exon 7 To Exon 9 (Pair 18)
Forward (1011,24)GGACACAAATTTAATGAAGCATCAAmplicon SizecDNA: 270 bpgenomic: 12,100
Reverse (1280,20)GCATCGGCCAACATCACAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.206 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops1.261 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-1.674 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATT
CCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGT
CCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATAC
TGTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAAAA
ATGCAGTGCTGCTGTGATGTTGGCCGATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2701011 - 1280
Exon 7 To Exon 8 (Pair 25)
Forward (955,24)GTCAAGGAGGAAATTGCATTAATAAmplicon SizecDNA: 118 bpgenomic: 6,756
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGAC
ACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)118955 - 1072
Exon 7 To Exon 8 (Pair 26)
Forward (956,24)TCAAGGAGGAAATTGCATTAATACAmplicon SizecDNA: 116 bpgenomic: 6,754
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACA
CAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)116956 - 1071
Exon 7 To Exon 9 (Pair 19)
Forward (1012,24)GACACAAATTTAATGAAGCATCACAmplicon SizecDNA: 266 bpgenomic: 12,096
Reverse (1277,20)TCGGCCAACATCACAGCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.18 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops1.589 kcal/mol in 3' area
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-1.674 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTC
CTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTC
CTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACT
GTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAAAAA
TGCAGTGCTGCTGTGATGTTGGCCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2661012 - 1277
Exon 7 To Exon 8 (Pair 27)
Forward (964,24)GAAATTGCATTAATACTGTTGGGTAmplicon SizecDNA: 108 bpgenomic: 6,746
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTA
ATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)108964 - 1071
Exon 7 To Exon 9 (Pair 20)
Forward (1012,24)GACACAAATTTAATGAAGCATCACAmplicon SizecDNA: 269 bpgenomic: 12,099
Reverse (1280,20)GCATCGGCCAACATCACAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.18 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops1.261 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-1.674 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTC
CTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTC
CTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACT
GTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAAAAA
TGCAGTGCTGCTGTGATGTTGGCCGATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2691012 - 1280
Exon 7 To Exon 8 (Pair 28)
Forward (960,24)GGAGGAAATTGCATTAATACTGTTAmplicon SizecDNA: 113 bpgenomic: 6,751
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAA
TTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)113960 - 1072
Exon 7 To Exon 9 (Pair 21)
Forward (958,24)AAGGAGGAAATTGCATTAATACTGAmplicon SizecDNA: 257 bpgenomic: 12,087
Reverse (1214,21)CCCATTTGCCAGAGCTGTGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACA
AATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGGAA
TCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCCTG
GTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTACA
CAGCTCTGGCAAATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)257958 - 1214
Exon 7 To Exon 8 (Pair 29)
Forward (954,24)TGTCAAGGAGGAAATTGCATTAATAmplicon SizecDNA: 118 bpgenomic: 6,756
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.541 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGA
CACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)118954 - 1071
Exon 7 To Exon 9 (Pair 22)
Forward (962,24)AGGAAATTGCATTAATACTGTTGGAmplicon SizecDNA: 253 bpgenomic: 12,083
Reverse (1214,21)CCCATTTGCCAGAGCTGTGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATT
TAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGGAATCTG
TGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCCTGGTTT
TTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTACACAGC
TCTGGCAAATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)253962 - 1214
Exon 7 To Exon 9 (Pair 23)
Forward (961,24)GAGGAAATTGCATTAATACTGTTGAmplicon SizecDNA: 254 bpgenomic: 12,084
Reverse (1214,21)CCCATTTGCCAGAGCTGTGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAAT
TTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGGAATCT
GTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCCTGGTT
TTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTACACAG
CTCTGGCAAATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)254961 - 1214
Exon 7 To Exon 8 (Pair 30)
Forward (958,24)AAGGAGGAAATTGCATTAATACTGAmplicon SizecDNA: 114 bpgenomic: 6,752
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACA
AATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)114958 - 1071
Exon 7 To Exon 9 (Pair 24)
Forward (957,24)CAAGGAGGAAATTGCATTAATACTAmplicon SizecDNA: 256 bpgenomic: 12,086
Reverse (1212,22)CATTTGCCAGAGCTGTGTAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.777 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACAC
AAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGGA
ATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCCT
GGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTAC
ACAGCTCTGGCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)256957 - 1212
Exon 7 To Exon 8 (Pair 31)
Forward (961,24)GAGGAAATTGCATTAATACTGTTGAmplicon SizecDNA: 112 bpgenomic: 6,750
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAAT
TTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)112961 - 1072
Exon 7 To Exon 8 (Pair 32)
Forward (964,24)GAAATTGCATTAATACTGTTGGGTAmplicon SizecDNA: 109 bpgenomic: 6,747
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTA
ATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)109964 - 1072
Exon 7 To Exon 9 (Pair 25)
Forward (1009,24)CTGGACACAAATTTAATGAAGCATAmplicon SizecDNA: 284 bpgenomic: 12,114
Reverse (1292,19)CCCTGGAGACCAGCATCGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.858 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops0.36 kcal/mol
Reverse Dimers-2.204 kcal/mol
Forward-Reverse Dimers-2.452 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCA
TTCCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGT
GTCCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGAT
ACTGTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAA
AAATGCAGTGCTGCTGTGATGTTGGCCGATGCTGGTCTCCAGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2841009 - 1292
Exon 7 To Exon 8 (Pair 33)
Forward (967,24)ATTGCATTAATACTGTTGGGTCTTAmplicon SizecDNA: 106 bpgenomic: 6,744
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.402 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTAATG
AAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)106967 - 1072
Exon 7 To Exon 9 (Pair 26)
Forward (956,24)TCAAGGAGGAAATTGCATTAATACAmplicon SizecDNA: 257 bpgenomic: 12,087
Reverse (1212,22)CATTTGCCAGAGCTGTGTAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.777 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACA
CAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGG
AATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCC
TGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTA
CACAGCTCTGGCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)257956 - 1212
Exon 7 To Exon 8 (Pair 34)
Forward (946,20)CTGGGCTCTGTCAAGGAGGAAmplicon SizecDNA: 126 bpgenomic: 6,764
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.88 kcal/mol in 3' area
Forward Dimers-0.348 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceCTGGGCTCTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCC
CTGCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTA
CCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)126946 - 1071
Exon 7 To Exon 8 (Pair 35)
Forward (948,21)GGGCTCTGTCAAGGAGGAAATAmplicon SizecDNA: 125 bpgenomic: 6,763
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.88 kcal/mol
Forward Dimers-0.004 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceGGGCTCTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCT
GCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACC
ATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)125948 - 1072
Exon 7 To Exon 8 (Pair 36)
Forward (968,24)TTGCATTAATACTGTTGGGTCTTTAmplicon SizecDNA: 106 bpgenomic: 6,744
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.402 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceTTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTAATGA
AGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)106968 - 1073
Exon 7 To Exon 9 (Pair 27)
Forward (1009,24)CTGGACACAAATTTAATGAAGCATAmplicon SizecDNA: 206 bpgenomic: 12,036
Reverse (1214,21)CCCATTTGCCAGAGCTGTGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.858 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.883 kcal/mol
Amplicon Folding-0.663 kcal/mol outside primersite
Amplicon SequenceCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCA
TTCCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGT
GTCCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGAT
ACTGTTACACAGCTCTGGCAAATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2061009 - 1214
Exon 7 To Exon 9 (Pair 28)
Forward (1010,24)TGGACACAAATTTAATGAAGCATCAmplicon SizecDNA: 281 bpgenomic: 12,111
Reverse (1290,19)CTGGAGACCAGCATCGGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.349 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops0.571 kcal/mol
Reverse Dimers-1.993 kcal/mol
Forward-Reverse Dimers-1.596 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCAT
TCCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTG
TCCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATA
CTGTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAAA
AATGCAGTGCTGCTGTGATGTTGGCCGATGCTGGTCTCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2811010 - 1290
Exon 7 To Exon 8 (Pair 37)
Forward (962,24)AGGAAATTGCATTAATACTGTTGGAmplicon SizecDNA: 112 bpgenomic: 6,750
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATT
TAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)112962 - 1073
Exon 7 To Exon 8 (Pair 38)
Forward (968,24)TTGCATTAATACTGTTGGGTCTTTAmplicon SizecDNA: 105 bpgenomic: 6,743
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.402 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceTTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTAATGA
AGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)105968 - 1072
Exon 7 To Exon 8 (Pair 39)
Forward (961,24)GAGGAAATTGCATTAATACTGTTGAmplicon SizecDNA: 113 bpgenomic: 6,751
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAAT
TTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)113961 - 1073
Exon 7 To Exon 8 (Pair 40)
Forward (958,24)AAGGAGGAAATTGCATTAATACTGAmplicon SizecDNA: 115 bpgenomic: 6,753
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACA
AATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)115958 - 1072
Exon 7 To Exon 9 (Pair 29)
Forward (954,24)TGTCAAGGAGGAAATTGCATTAATAmplicon SizecDNA: 261 bpgenomic: 12,091
Reverse (1214,21)CCCATTTGCCAGAGCTGTGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.541 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGA
CACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
GGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCT
CCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGT
TACACAGCTCTGGCAAATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)261954 - 1214
Exon 7 To Exon 8 (Pair 41)
Forward (946,20)CTGGGCTCTGTCAAGGAGGAAmplicon SizecDNA: 127 bpgenomic: 6,765
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.88 kcal/mol in 3' area
Forward Dimers-0.348 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceCTGGGCTCTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCC
CTGCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTA
CCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)127946 - 1072
Exon 7 To Exon 9 (Pair 30)
Forward (959,24)AGGAGGAAATTGCATTAATACTGTAmplicon SizecDNA: 254 bpgenomic: 12,084
Reverse (1212,22)CATTTGCCAGAGCTGTGTAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.777 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAA
ATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGGAAT
CTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCCTGG
TTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTACAC
AGCTCTGGCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)254959 - 1212
Exon 7 To Exon 8 (Pair 42)
Forward (954,24)TGTCAAGGAGGAAATTGCATTAATAmplicon SizecDNA: 120 bpgenomic: 6,758
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.541 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGA
CACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)120954 - 1073
Exon 7 To Exon 8 (Pair 43)
Forward (948,21)GGGCTCTGTCAAGGAGGAAATAmplicon SizecDNA: 126 bpgenomic: 6,764
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.88 kcal/mol
Forward Dimers-0.004 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceGGGCTCTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCT
GCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACC
ATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)126948 - 1073
Exon 7 To Exon 9 (Pair 31)
Forward (965,24)AAATTGCATTAATACTGTTGGGTCAmplicon SizecDNA: 248 bpgenomic: 12,078
Reverse (1212,22)CATTTGCCAGAGCTGTGTAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.777 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATTTAA
TGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGGAATCTGTGA
TGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCCTGGTTTTTA
CCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTACACAGCTCT
GGCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)248965 - 1212
Exon 7 To Exon 9 (Pair 32)
Forward (955,24)GTCAAGGAGGAAATTGCATTAATAAmplicon SizecDNA: 258 bpgenomic: 12,088
Reverse (1212,22)CATTTGCCAGAGCTGTGTAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.777 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGAC
ACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTG
GAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTC
CTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTT
ACACAGCTCTGGCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)258955 - 1212
Exon 7 To Exon 9 (Pair 33)
Forward (1010,24)TGGACACAAATTTAATGAAGCATCAmplicon SizecDNA: 282 bpgenomic: 12,112
Reverse (1291,19)CCTGGAGACCAGCATCGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.349 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops0.36 kcal/mol
Reverse Dimers-2.204 kcal/mol
Forward-Reverse Dimers-1.596 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCAT
TCCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTG
TCCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATA
CTGTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAAA
AATGCAGTGCTGCTGTGATGTTGGCCGATGCTGGTCTCCAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2821010 - 1291
Exon 7 To Exon 8 (Pair 44)
Forward (959,24)AGGAGGAAATTGCATTAATACTGTAmplicon SizecDNA: 114 bpgenomic: 6,752
Reverse (1072,22)GGAATGGTACTGCATTCGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAA
ATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)114959 - 1072
Exon 7 To Exon 9 (Pair 34)
Forward (961,24)GAGGAAATTGCATTAATACTGTTGAmplicon SizecDNA: 252 bpgenomic: 12,082
Reverse (1212,22)CATTTGCCAGAGCTGTGTAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.777 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAAT
TTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGGAATCT
GTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCCTGGTT
TTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTACACAG
CTCTGGCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)252961 - 1212
Exon 7 To Exon 9 (Pair 35)
Forward (1011,24)GGACACAAATTTAATGAAGCATCAAmplicon SizecDNA: 280 bpgenomic: 12,110
Reverse (1290,19)CTGGAGACCAGCATCGGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.206 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops0.571 kcal/mol
Reverse Dimers-1.993 kcal/mol
Forward-Reverse Dimers-1.505 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATT
CCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGT
CCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATAC
TGTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAAAA
ATGCAGTGCTGCTGTGATGTTGGCCGATGCTGGTCTCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2801011 - 1290
Exon 7 To Exon 9 (Pair 36)
Forward (962,24)AGGAAATTGCATTAATACTGTTGGAmplicon SizecDNA: 251 bpgenomic: 12,081
Reverse (1212,22)CATTTGCCAGAGCTGTGTAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.777 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAATT
TAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGGAATCTG
TGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCCTGGTTT
TTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTACACAGC
TCTGGCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)251962 - 1212
Exon 7 To Exon 8 (Pair 45)
Forward (959,24)AGGAGGAAATTGCATTAATACTGTAmplicon SizecDNA: 115 bpgenomic: 6,753
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAA
ATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)115959 - 1073
Exon 7 To Exon 9 (Pair 37)
Forward (960,24)GGAGGAAATTGCATTAATACTGTTAmplicon SizecDNA: 255 bpgenomic: 12,085
Reverse (1214,21)CCCATTTGCCAGAGCTGTGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAA
TTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGGAATC
TGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCCTGGT
TTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTACACA
GCTCTGGCAAATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)255960 - 1214
Exon 7 To Exon 9 (Pair 38)
Forward (956,24)TCAAGGAGGAAATTGCATTAATACAmplicon SizecDNA: 259 bpgenomic: 12,089
Reverse (1214,21)CCCATTTGCCAGAGCTGTGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.324 kcal/mol
Amplicon Folding-0.839 kcal/mol outside primersite
Amplicon SequenceTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACA
CAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCTGG
AATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTGTCCTCC
TGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATACTGTTA
CACAGCTCTGGCAAATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)259956 - 1214
Exon 7 To Exon 9 (Pair 39)
Forward (1009,24)CTGGACACAAATTTAATGAAGCATAmplicon SizecDNA: 272 bpgenomic: 12,102
Reverse (1280,20)GCATCGGCCAACATCACAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.858 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops1.261 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-1.674 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCA
TTCCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGT
GTCCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGAT
ACTGTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAA
AAATGCAGTGCTGCTGTGATGTTGGCCGATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2721009 - 1280
Exon 7 To Exon 8 (Pair 46)
Forward (946,20)CTGGGCTCTGTCAAGGAGGAAmplicon SizecDNA: 128 bpgenomic: 6,766
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.88 kcal/mol in 3' area
Forward Dimers-0.348 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceCTGGGCTCTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCC
CTGCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTA
CCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)128946 - 1073
Exon 7 To Exon 8 (Pair 47)
Forward (957,24)CAAGGAGGAAATTGCATTAATACTAmplicon SizecDNA: 117 bpgenomic: 6,755
Reverse (1073,22)AGGAATGGTACTGCATTCGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.273 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.602 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACAC
AAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCATTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)117957 - 1073
Exon 7 To Exon 9 (Pair 40)
Forward (1009,24)CTGGACACAAATTTAATGAAGCATAmplicon SizecDNA: 204 bpgenomic: 12,034
Reverse (1212,22)CATTTGCCAGAGCTGTGTAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.858 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops0.777 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.883 kcal/mol
Amplicon Folding-0.663 kcal/mol outside primersite
Amplicon SequenceCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCA
TTCCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGT
GTCCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGAT
ACTGTTACACAGCTCTGGCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2041009 - 1212
Exon 7 To Exon 9 (Pair 41)
Forward (1010,24)TGGACACAAATTTAATGAAGCATCAmplicon SizecDNA: 283 bpgenomic: 12,113
Reverse (1292,19)CCCTGGAGACCAGCATCGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.349 kcal/mol in 3' area
Forward Dimers-1.648 kcal/mol
Reverse Loops0.36 kcal/mol
Reverse Dimers-2.204 kcal/mol
Forward-Reverse Dimers-1.596 kcal/mol
Amplicon Folding-1.785 kcal/mol outside primersite
Amplicon SequenceTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACCAT
TCCTGGAATCTGTGATGGGGGCGAGTGTACAAACACAGTCAGCAGTTACTTTTGCAAGTG
TCCTCCTGGTTTTTACCCCTCTCCCGATGGTACCCGATGCGTAGATGTTCGCCCCGGATA
CTGTTACACAGCTCTGGCAAATGGGCGCTGTTCTAACCAACTGCCCCAGTCCATAACAAA
AATGCAGTGCTGCTGTGATGTTGGCCGATGCTGGTCTCCAGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)2831010 - 1292
Exon 7 To Exon 8 (Pair 48)
Forward (948,21)GGGCTCTGTCAAGGAGGAAATAmplicon SizecDNA: 124 bpgenomic: 6,762
Reverse (1071,23)GAATGGTACTGCATTCGTCAATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.88 kcal/mol
Forward Dimers-0.004 kcal/mol
Reverse Loops0.738 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding-0.176 kcal/mol outside primersite
Amplicon SequenceGGGCTCTGTCAAGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCT
GCTGGACACAAATTTAATGAAGCATCACAAAAATGTGAAGATATTGACGAATGCAGTACC
ATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001287085 (FBN1)124948 - 1071
 

See below for some more details.

Program Output:

Loading ...