Design Results for gabra4

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size100

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 2 (Pair 20)
Forward (962,23)TGAAGTATGGCATGTTGCAAAGAAmplicon SizecDNA: 199 bpgenomic: 591
Reverse (1160,22)ATAACCATCGAGCAAACTGTCCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTGTC
CGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAATC
CCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTGGA
CAGTTTGCTCGATGGTTAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)13160 - 190
NM_000809 (GABRA4)199962 - 1160
NM_001204267 (GABRA4)13160 - 190
Exon 1 To Exon 2 (Pair 19)
Forward (962,23)TGAAGTATGGCATGTTGCAAAGAAmplicon SizecDNA: 200 bpgenomic: 592
Reverse (1161,22)CATAACCATCGAGCAAACTGTCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTGTC
CGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAATC
CCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTGGA
CAGTTTGCTCGATGGTTATG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)13260 - 191
NM_001204266 (GABRA4)13260 - 191
NM_000809 (GABRA4)200962 - 1161
Exon 1 To Exon 2 (Pair 18)
Forward (961,23)TTGAAGTATGGCATGTTGCAAAGAmplicon SizecDNA: 201 bpgenomic: 593
Reverse (1161,22)CATAACCATCGAGCAAACTGTCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTGT
CCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAAT
CCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTGG
ACAGTTTGCTCGATGGTTATG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)13359 - 191
NM_000809 (GABRA4)201961 - 1161
NM_001204266 (GABRA4)13359 - 191
Exon 1 To Exon 2 (Pair 17)
Forward (962,23)TGAAGTATGGCATGTTGCAAAGAAmplicon SizecDNA: 198 bpgenomic: 590
Reverse (1159,22)TAACCATCGAGCAAACTGTCCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTGTC
CGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAATC
CCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTGGA
CAGTTTGCTCGATGGTTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000809 (GABRA4)198962 - 1159
NM_001204266 (GABRA4)13060 - 189
NM_001204267 (GABRA4)13060 - 189
Exon 1 To Exon 2 (Pair 16)
Forward (961,23)TTGAAGTATGGCATGTTGCAAAGAmplicon SizecDNA: 197 bpgenomic: 589
Reverse (1157,21)ACCATCGAGCAAACTGTCCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTGT
CCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAAT
CCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTGG
ACAGTTTGCTCGATGGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)12959 - 187
NM_000809 (GABRA4)197961 - 1157
NM_001204267 (GABRA4)12959 - 187
Exon 1 To Exon 2 (Pair 15)
Forward (962,23)TGAAGTATGGCATGTTGCAAAGAAmplicon SizecDNA: 194 bpgenomic: 586
Reverse (1155,21)CATCGAGCAAACTGTCCAGGANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-1.802 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTGTC
CGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAATC
CCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTGGA
CAGTTTGCTCGATG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000809 (GABRA4)194962 - 1155
NM_001204266 (GABRA4)12660 - 185
NM_001204267 (GABRA4)12660 - 185
Exon 1 To Exon 2 (Pair 14)
Forward (959,22)GCTTGAAGTATGGCATGTTGCAAmplicon SizecDNA: 201 bpgenomic: 593
Reverse (1159,22)TAACCATCGAGCAAACTGTCCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceGCTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCT
GTCCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGA
ATCCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCT
GGACAGTTTGCTCGATGGTTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000809 (GABRA4)201959 - 1159
NM_001204266 (GABRA4)13357 - 189
NM_001204267 (GABRA4)13357 - 189
Exon 1 To Exon 2 (Pair 13)
Forward (959,22)GCTTGAAGTATGGCATGTTGCAAmplicon SizecDNA: 202 bpgenomic: 594
Reverse (1160,22)ATAACCATCGAGCAAACTGTCCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceGCTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCT
GTCCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGA
ATCCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCT
GGACAGTTTGCTCGATGGTTAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000809 (GABRA4)202959 - 1160
NM_001204266 (GABRA4)13457 - 190
NM_001204267 (GABRA4)13457 - 190
Exon 1 To Exon 2 (Pair 12)
Forward (959,22)GCTTGAAGTATGGCATGTTGCAAmplicon SizecDNA: 203 bpgenomic: 595
Reverse (1161,22)CATAACCATCGAGCAAACTGTCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceGCTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCT
GTCCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGA
ATCCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCT
GGACAGTTTGCTCGATGGTTATG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000809 (GABRA4)203959 - 1161
NM_001204266 (GABRA4)13557 - 191
NM_001204267 (GABRA4)13557 - 191
Exon 1 To Exon 2 (Pair 11)
Forward (959,22)GCTTGAAGTATGGCATGTTGCAAmplicon SizecDNA: 205 bpgenomic: 597
Reverse (1163,22)GTCATAACCATCGAGCAAACTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceGCTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCT
GTCCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGA
ATCCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCT
GGACAGTTTGCTCGATGGTTATGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)13757 - 193
NM_000809 (GABRA4)205959 - 1163
NM_001204267 (GABRA4)13757 - 193
Exon 1 To Exon 2 (Pair 10)
Forward (959,22)GCTTGAAGTATGGCATGTTGCAAmplicon SizecDNA: 207 bpgenomic: 599
Reverse (1165,23)TTGTCATAACCATCGAGCAAACTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.467 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceGCTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCT
GTCCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGA
ATCCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCT
GGACAGTTTGCTCGATGGTTATGACAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)13957 - 195
NM_000809 (GABRA4)207959 - 1165
NM_001204267 (GABRA4)13957 - 195
Exon 1 To Exon 2 (Pair 9)
Forward (961,23)TTGAAGTATGGCATGTTGCAAAGAmplicon SizecDNA: 200 bpgenomic: 592
Reverse (1160,22)ATAACCATCGAGCAAACTGTCCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTGT
CCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAAT
CCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTGG
ACAGTTTGCTCGATGGTTAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)13259 - 190
NM_001204266 (GABRA4)13259 - 190
NM_000809 (GABRA4)200961 - 1160
Exon 1 To Exon 2 (Pair 8)
Forward (959,22)GCTTGAAGTATGGCATGTTGCAAmplicon SizecDNA: 199 bpgenomic: 591
Reverse (1157,21)ACCATCGAGCAAACTGTCCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceGCTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCT
GTCCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGA
ATCCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCT
GGACAGTTTGCTCGATGGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)13157 - 187
NM_000809 (GABRA4)199959 - 1157
NM_001204267 (GABRA4)13157 - 187
Exon 1 To Exon 2 (Pair 7)
Forward (960,23)CTTGAAGTATGGCATGTTGCAAAAmplicon SizecDNA: 200 bpgenomic: 592
Reverse (1159,22)TAACCATCGAGCAAACTGTCCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceCTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTG
TCCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAA
TCCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTG
GACAGTTTGCTCGATGGTTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)13258 - 189
NM_000809 (GABRA4)200960 - 1159
NM_001204267 (GABRA4)13258 - 189
Exon 1 To Exon 2 (Pair 6)
Forward (959,22)GCTTGAAGTATGGCATGTTGCAAmplicon SizecDNA: 197 bpgenomic: 589
Reverse (1155,21)CATCGAGCAAACTGTCCAGGANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-1.898 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceGCTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCT
GTCCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGA
ATCCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCT
GGACAGTTTGCTCGATG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)12957 - 185
NM_001204266 (GABRA4)12957 - 185
NM_000809 (GABRA4)197959 - 1155
Exon 1 To Exon 2 (Pair 5)
Forward (960,23)CTTGAAGTATGGCATGTTGCAAAAmplicon SizecDNA: 204 bpgenomic: 596
Reverse (1163,22)GTCATAACCATCGAGCAAACTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceCTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTG
TCCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAA
TCCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTG
GACAGTTTGCTCGATGGTTATGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)13658 - 193
NM_000809 (GABRA4)204960 - 1163
NM_001204267 (GABRA4)13658 - 193
Exon 1 To Exon 2 (Pair 4)
Forward (960,23)CTTGAAGTATGGCATGTTGCAAAAmplicon SizecDNA: 206 bpgenomic: 598
Reverse (1165,23)TTGTCATAACCATCGAGCAAACTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.467 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceCTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTG
TCCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAA
TCCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTG
GACAGTTTGCTCGATGGTTATGACAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000809 (GABRA4)206960 - 1165
NM_001204266 (GABRA4)13858 - 195
NM_001204267 (GABRA4)13858 - 195
Exon 1 To Exon 2 (Pair 3)
Forward (962,23)TGAAGTATGGCATGTTGCAAAGAAmplicon SizecDNA: 202 bpgenomic: 594
Reverse (1163,22)GTCATAACCATCGAGCAAACTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTGTC
CGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAATC
CCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTGGA
CAGTTTGCTCGATGGTTATGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000809 (GABRA4)202962 - 1163
NM_001204266 (GABRA4)13460 - 193
NM_001204267 (GABRA4)13460 - 193
Exon 1 To Exon 2 (Pair 2)
Forward (962,23)TGAAGTATGGCATGTTGCAAAGAAmplicon SizecDNA: 204 bpgenomic: 596
Reverse (1165,23)TTGTCATAACCATCGAGCAAACTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol
Forward Dimers-2.781 kcal/mol
Reverse Loops1.467 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTGTC
CGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAATC
CCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTGGA
CAGTTTGCTCGATGGTTATGACAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)13660 - 195
NM_000809 (GABRA4)204962 - 1165
NM_001204266 (GABRA4)13660 - 195
Exon 1 To Exon 2 (Pair 1)
Forward (961,23)TTGAAGTATGGCATGTTGCAAAGAmplicon SizecDNA: 205 bpgenomic: 597
Reverse (1165,23)TTGTCATAACCATCGAGCAAACTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.467 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTGT
CCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAAT
CCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTGG
ACAGTTTGCTCGATGGTTATGACAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)13759 - 195
NM_001204267 (GABRA4)13759 - 195
NM_000809 (GABRA4)205961 - 1165
Exon 1 To Exon 2 (Pair 21)
Forward (960,23)CTTGAAGTATGGCATGTTGCAAAAmplicon SizecDNA: 198 bpgenomic: 590
Reverse (1157,21)ACCATCGAGCAAACTGTCCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceCTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTG
TCCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAA
TCCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTG
GACAGTTTGCTCGATGGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000809 (GABRA4)198960 - 1157
NM_001204266 (GABRA4)13058 - 187
NM_001204267 (GABRA4)13058 - 187
Exon 1 To Exon 2 (Pair 22)
Forward (961,23)TTGAAGTATGGCATGTTGCAAAGAmplicon SizecDNA: 199 bpgenomic: 591
Reverse (1159,22)TAACCATCGAGCAAACTGTCCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTGT
CCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAAT
CCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTGG
ACAGTTTGCTCGATGGTTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)13159 - 189
NM_000809 (GABRA4)199961 - 1159
NM_001204267 (GABRA4)13159 - 189
Exon 1 To Exon 2 (Pair 23)
Forward (960,23)CTTGAAGTATGGCATGTTGCAAAAmplicon SizecDNA: 202 bpgenomic: 594
Reverse (1161,22)CATAACCATCGAGCAAACTGTCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceCTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTG
TCCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAA
TCCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTG
GACAGTTTGCTCGATGGTTATG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000809 (GABRA4)202960 - 1161
NM_001204266 (GABRA4)13458 - 191
NM_001204267 (GABRA4)13458 - 191
Exon 1 To Exon 2 (Pair 24)
Forward (961,23)TTGAAGTATGGCATGTTGCAAAGAmplicon SizecDNA: 203 bpgenomic: 595
Reverse (1163,22)GTCATAACCATCGAGCAAACTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTGT
CCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAAT
CCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTGG
ACAGTTTGCTCGATGGTTATGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000809 (GABRA4)203961 - 1163
NM_001204266 (GABRA4)13559 - 193
NM_001204267 (GABRA4)13559 - 193
Exon 1 To Exon 2 (Pair 25)
Forward (962,23)TGAAGTATGGCATGTTGCAAAGAAmplicon SizecDNA: 196 bpgenomic: 588
Reverse (1157,21)ACCATCGAGCAAACTGTCCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTGTC
CGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAATC
CCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTGGA
CAGTTTGCTCGATGGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)12860 - 187
NM_000809 (GABRA4)196962 - 1157
NM_001204266 (GABRA4)12860 - 187
Exon 1 To Exon 2 (Pair 26)
Forward (960,23)CTTGAAGTATGGCATGTTGCAAAAmplicon SizecDNA: 201 bpgenomic: 593
Reverse (1160,22)ATAACCATCGAGCAAACTGTCCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.418 kcal/mol in 3' area
Forward Dimers-2.781 kcal/mol
Reverse Loops1.07 kcal/mol in 3' area
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-2.457 kcal/mol outside primersite
Amplicon SequenceCTTGAAGTATGGCATGTTGCAAAGATGGTTTCTGCCAAGAAGGTACCCGCGATCGCTCTG
TCCGCCGGGGTCAGTTTCGCCCTCCTGCGCTTCCTGTGCCTGGCGGTTTGTTTAAACGAA
TCCCCAGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTG
GACAGTTTGCTCGATGGTTAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)13358 - 190
NM_001204266 (GABRA4)13358 - 190
NM_000809 (GABRA4)201960 - 1160
Exon 2 To Exon 4 (Pair 54)
Forward (1137,21)CTGGACAGTTTGCTCGATGGTAmplicon SizecDNA: 289 bpgenomic: 15,418
Reverse (1425,23)GAGCTGTCATATTATGTGAGACANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.24 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTT
ACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATG
GAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGAC
GGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGAT
ACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)289167 - 455
NM_001204266 (GABRA4)289167 - 455
NM_000809 (GABRA4)2891137 - 1425
Exon 2 To Exon 3 (Pair 31)
Forward (1133,21)CATCCTGGACAGTTTGCTCGAAmplicon SizecDNA: 106 bpgenomic: 13,835
Reverse (1238,22)AGGTCCAAAGCTGGTGACATATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol in 3' area
Forward Dimers-1.922 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceCATCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCC
TGTTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)106163 - 268
NM_001204266 (GABRA4)106163 - 268
NM_000809 (GABRA4)1061133 - 1238
Exon 2 To Exon 4 (Pair 53)
Forward (1142,22)CAGTTTGCTCGATGGTTATGACAmplicon SizecDNA: 292 bpgenomic: 15,421
Reverse (1433,24)CTTATTTGGAGCTGTCATATTATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.828 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.902 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACAGA
AGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGAATA
CACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGGCCC
CATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATACTTT
CTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAATAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)292172 - 463
NM_001204266 (GABRA4)292172 - 463
NM_000809 (GABRA4)2921142 - 1433
Exon 2 To Exon 3 (Pair 30)
Forward (1137,21)CTGGACAGTTTGCTCGATGGTAmplicon SizecDNA: 104 bpgenomic: 13,833
Reverse (1240,21)ACAGGTCCAAAGCTGGTGACANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTT
ACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)104167 - 270
NM_001204266 (GABRA4)104167 - 270
NM_000809 (GABRA4)1041137 - 1240
Exon 2 To Exon 4 (Pair 52)
Forward (1135,21)TCCTGGACAGTTTGCTCGATGAmplicon SizecDNA: 299 bpgenomic: 15,428
Reverse (1433,24)CTTATTTGGAGCTGTCATATTATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.828 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceTCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTG
TTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAA
TGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATG
ACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTG
ATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAATAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)299165 - 463
NM_000809 (GABRA4)2991135 - 1433
NM_001204266 (GABRA4)299165 - 463
Exon 2 To Exon 3 (Pair 29)
Forward (1135,21)TCCTGGACAGTTTGCTCGATGAmplicon SizecDNA: 107 bpgenomic: 13,836
Reverse (1241,21)AACAGGTCCAAAGCTGGTGACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops0.947 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceTCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTG
TTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)107165 - 271
NM_000809 (GABRA4)1071135 - 1241
NM_001204266 (GABRA4)107165 - 271
Exon 2 To Exon 3 (Pair 28)
Forward (1137,21)CTGGACAGTTTGCTCGATGGTAmplicon SizecDNA: 105 bpgenomic: 13,834
Reverse (1241,21)AACAGGTCCAAAGCTGGTGACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.947 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTT
ACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)1051137 - 1241
NM_001204266 (GABRA4)105167 - 271
NM_001204267 (GABRA4)105167 - 271
Exon 2 To Exon 3 (Pair 27)
Forward (1140,22)GACAGTTTGCTCGATGGTTATGAmplicon SizecDNA: 99 bpgenomic: 13,828
Reverse (1238,22)AGGTCCAAAGCTGGTGACATATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.88 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACA
GAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)99170 - 268
NM_000809 (GABRA4)991140 - 1238
NM_001204266 (GABRA4)99170 - 268
Exon 2 To Exon 4 (Pair 51)
Forward (1140,22)GACAGTTTGCTCGATGGTTATGAmplicon SizecDNA: 292 bpgenomic: 15,421
Reverse (1431,24)TATTTGGAGCTGTCATATTATGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.828 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.32 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACA
GAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGAA
TACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGGC
CCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATACT
TTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)292170 - 461
NM_000809 (GABRA4)2921140 - 1431
NM_001204267 (GABRA4)292170 - 461
Exon 2 To Exon 3 (Pair 26)
Forward (1135,21)TCCTGGACAGTTTGCTCGATGAmplicon SizecDNA: 106 bpgenomic: 13,835
Reverse (1240,21)ACAGGTCCAAAGCTGGTGACANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceTCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTG
TTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)106165 - 270
NM_000809 (GABRA4)1061135 - 1240
NM_001204267 (GABRA4)106165 - 270
Exon 2 To Exon 4 (Pair 50)
Forward (1139,22)GGACAGTTTGCTCGATGGTTATAmplicon SizecDNA: 289 bpgenomic: 15,418
Reverse (1427,23)TGGAGCTGTCATATTATGTGAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTAC
AGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGA
ATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGG
CCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATAC
TTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)2891139 - 1427
NM_001204266 (GABRA4)289169 - 457
NM_001204267 (GABRA4)289169 - 457
Exon 2 To Exon 3 (Pair 25)
Forward (1133,21)CATCCTGGACAGTTTGCTCGAAmplicon SizecDNA: 109 bpgenomic: 13,838
Reverse (1241,21)AACAGGTCCAAAGCTGGTGACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol in 3' area
Forward Dimers-1.922 kcal/mol
Reverse Loops0.947 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceCATCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCC
TGTTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)109163 - 271
NM_001204266 (GABRA4)109163 - 271
NM_000809 (GABRA4)1091133 - 1241
Exon 2 To Exon 4 (Pair 49)
Forward (1139,22)GGACAGTTTGCTCGATGGTTATAmplicon SizecDNA: 295 bpgenomic: 15,424
Reverse (1433,24)CTTATTTGGAGCTGTCATATTATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.828 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTAC
AGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGA
ATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGG
CCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATAC
TTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAATAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)2951139 - 1433
NM_001204266 (GABRA4)295169 - 463
NM_001204267 (GABRA4)295169 - 463
Exon 2 To Exon 4 (Pair 48)
Forward (1142,22)CAGTTTGCTCGATGGTTATGACAmplicon SizecDNA: 274 bpgenomic: 15,403
Reverse (1415,24)ATTATGTGAGACAGATTTCTTTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.289 kcal/mol in 3' area
Reverse Dimers-0.694 kcal/mol
Forward-Reverse Dimers-1.117 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACAGA
AGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGAATA
CACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGGCCC
CATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATACTTT
CTTCAGGAATGGAAAGAAATCTGTCTCACATAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)2741142 - 1415
NM_001204266 (GABRA4)274172 - 445
NM_001204267 (GABRA4)274172 - 445
Exon 2 To Exon 4 (Pair 47)
Forward (1140,22)GACAGTTTGCTCGATGGTTATGAmplicon SizecDNA: 276 bpgenomic: 15,405
Reverse (1415,24)ATTATGTGAGACAGATTTCTTTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.289 kcal/mol in 3' area
Reverse Dimers-0.694 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACA
GAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGAA
TACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGGC
CCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATACT
TTCTTCAGGAATGGAAAGAAATCTGTCTCACATAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)276170 - 445
NM_001204266 (GABRA4)276170 - 445
NM_000809 (GABRA4)2761140 - 1415
Exon 2 To Exon 4 (Pair 46)
Forward (1139,22)GGACAGTTTGCTCGATGGTTATAmplicon SizecDNA: 282 bpgenomic: 15,411
Reverse (1420,24)GTCATATTATGTGAGACAGATTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.476 kcal/mol
Reverse Dimers-0.694 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTAC
AGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGA
ATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGG
CCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATAC
TTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)282169 - 450
NM_000809 (GABRA4)2821139 - 1420
NM_001204267 (GABRA4)282169 - 450
Exon 2 To Exon 4 (Pair 45)
Forward (1140,22)GACAGTTTGCTCGATGGTTATGAmplicon SizecDNA: 291 bpgenomic: 15,420
Reverse (1430,24)ATTTGGAGCTGTCATATTATGTGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.32 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACA
GAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGAA
TACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGGC
CCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATACT
TTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)291170 - 460
NM_000809 (GABRA4)2911140 - 1430
NM_001204266 (GABRA4)291170 - 460
Exon 2 To Exon 4 (Pair 44)
Forward (1138,22)TGGACAGTTTGCTCGATGGTTAAmplicon SizecDNA: 290 bpgenomic: 15,419
Reverse (1427,23)TGGAGCTGTCATATTATGTGAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTA
CAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGG
AATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACG
GCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATA
CTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)290168 - 457
NM_001204266 (GABRA4)290168 - 457
NM_000809 (GABRA4)2901138 - 1427
Exon 2 To Exon 3 (Pair 24)
Forward (1140,22)GACAGTTTGCTCGATGGTTATGAmplicon SizecDNA: 98 bpgenomic: 13,827
Reverse (1237,22)GGTCCAAAGCTGGTGACATATANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.88 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACA
GAAGTGAAAACTGACATATATGTCACCAGCTTTGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)981140 - 1237
NM_001204266 (GABRA4)98170 - 267
NM_001204267 (GABRA4)98170 - 267
Exon 2 To Exon 3 (Pair 23)
Forward (1139,22)GGACAGTTTGCTCGATGGTTATAmplicon SizecDNA: 102 bpgenomic: 13,831
Reverse (1240,21)ACAGGTCCAAAGCTGGTGACANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.01 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTAC
AGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)102169 - 270
NM_000809 (GABRA4)1021139 - 1240
NM_001204266 (GABRA4)102169 - 270
Exon 2 To Exon 4 (Pair 43)
Forward (1138,22)TGGACAGTTTGCTCGATGGTTAAmplicon SizecDNA: 288 bpgenomic: 15,417
Reverse (1425,23)GAGCTGTCATATTATGTGAGACANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.24 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTA
CAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGG
AATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACG
GCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATA
CTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)288168 - 455
NM_000809 (GABRA4)2881138 - 1425
NM_001204267 (GABRA4)288168 - 455
Exon 2 To Exon 3 (Pair 22)
Forward (1142,22)CAGTTTGCTCGATGGTTATGACAmplicon SizecDNA: 97 bpgenomic: 13,826
Reverse (1238,22)AGGTCCAAAGCTGGTGACATATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.88 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceCAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACAGA
AGTGAAAACTGACATATATGTCACCAGCTTTGGACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)971142 - 1238
NM_001204266 (GABRA4)97172 - 268
NM_001204267 (GABRA4)97172 - 268
Exon 2 To Exon 4 (Pair 42)
Forward (1133,21)CATCCTGGACAGTTTGCTCGAAmplicon SizecDNA: 288 bpgenomic: 15,417
Reverse (1420,24)GTCATATTATGTGAGACAGATTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol in 3' area
Forward Dimers-1.922 kcal/mol
Reverse Loops1.476 kcal/mol
Reverse Dimers-0.694 kcal/mol
Forward-Reverse Dimers-1.273 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCATCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCC
TGTTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGA
AATGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATA
TGACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCC
TGATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)288163 - 450
NM_000809 (GABRA4)2881133 - 1420
NM_001204267 (GABRA4)288163 - 450
Exon 2 To Exon 4 (Pair 41)
Forward (1133,21)CATCCTGGACAGTTTGCTCGAAmplicon SizecDNA: 301 bpgenomic: 15,430
Reverse (1433,24)CTTATTTGGAGCTGTCATATTATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol in 3' area
Forward Dimers-1.922 kcal/mol
Reverse Loops1.828 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCATCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCC
TGTTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGA
AATGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATA
TGACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCC
TGATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAATAA
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)301163 - 463
NM_000809 (GABRA4)3011133 - 1433
NM_001204267 (GABRA4)301163 - 463
Exon 2 To Exon 3 (Pair 21)
Forward (1137,21)CTGGACAGTTTGCTCGATGGTAmplicon SizecDNA: 102 bpgenomic: 13,831
Reverse (1238,22)AGGTCCAAAGCTGGTGACATATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTT
ACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)1021137 - 1238
NM_001204266 (GABRA4)102167 - 268
NM_001204267 (GABRA4)102167 - 268
Exon 2 To Exon 4 (Pair 40)
Forward (1140,22)GACAGTTTGCTCGATGGTTATGAmplicon SizecDNA: 295 bpgenomic: 15,424
Reverse (1434,24)GCTTATTTGGAGCTGTCATATTATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.972 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.32 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACA
GAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGAA
TACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGGC
CCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATACT
TTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAATAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)295170 - 464
NM_001204266 (GABRA4)295170 - 464
NM_000809 (GABRA4)2951140 - 1434
Exon 2 To Exon 4 (Pair 39)
Forward (1140,22)GACAGTTTGCTCGATGGTTATGAmplicon SizecDNA: 281 bpgenomic: 15,410
Reverse (1420,24)GTCATATTATGTGAGACAGATTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.476 kcal/mol
Reverse Dimers-0.694 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACA
GAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGAA
TACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGGC
CCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATACT
TTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)2811140 - 1420
NM_001204266 (GABRA4)281170 - 450
NM_001204267 (GABRA4)281170 - 450
Exon 2 To Exon 4 (Pair 38)
Forward (1140,22)GACAGTTTGCTCGATGGTTATGAmplicon SizecDNA: 289 bpgenomic: 15,418
Reverse (1428,23)TTGGAGCTGTCATATTATGTGAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.32 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACA
GAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGAA
TACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGGC
CCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATACT
TTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)289170 - 458
NM_000809 (GABRA4)2891140 - 1428
NM_001204266 (GABRA4)289170 - 458
Exon 2 To Exon 3 (Pair 20)
Forward (1133,21)CATCCTGGACAGTTTGCTCGAAmplicon SizecDNA: 107 bpgenomic: 13,836
Reverse (1239,21)CAGGTCCAAAGCTGGTGACATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol in 3' area
Forward Dimers-1.922 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceCATCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCC
TGTTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)1071133 - 1239
NM_001204266 (GABRA4)107163 - 269
NM_001204267 (GABRA4)107163 - 269
Exon 2 To Exon 3 (Pair 19)
Forward (1138,22)TGGACAGTTTGCTCGATGGTTAAmplicon SizecDNA: 104 bpgenomic: 13,833
Reverse (1241,21)AACAGGTCCAAAGCTGGTGACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.947 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTA
CAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)104168 - 271
NM_000809 (GABRA4)1041138 - 1241
NM_001204267 (GABRA4)104168 - 271
Exon 2 To Exon 4 (Pair 37)
Forward (1142,22)CAGTTTGCTCGATGGTTATGACAmplicon SizecDNA: 289 bpgenomic: 15,418
Reverse (1430,24)ATTTGGAGCTGTCATATTATGTGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.902 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACAGA
AGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGAATA
CACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGGCCC
CATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATACTTT
CTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)289172 - 460
NM_001204266 (GABRA4)289172 - 460
NM_000809 (GABRA4)2891142 - 1430
Exon 2 To Exon 3 (Pair 18)
Forward (1137,21)CTGGACAGTTTGCTCGATGGTAmplicon SizecDNA: 103 bpgenomic: 13,832
Reverse (1239,21)CAGGTCCAAAGCTGGTGACATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTT
ACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)1031137 - 1239
NM_001204266 (GABRA4)103167 - 269
NM_001204267 (GABRA4)103167 - 269
Exon 2 To Exon 4 (Pair 36)
Forward (1137,21)CTGGACAGTTTGCTCGATGGTAmplicon SizecDNA: 298 bpgenomic: 15,427
Reverse (1434,24)GCTTATTTGGAGCTGTCATATTATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.972 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTT
ACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATG
GAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGAC
GGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGAT
ACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAATAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)298167 - 464
NM_000809 (GABRA4)2981137 - 1434
NM_001204267 (GABRA4)298167 - 464
Exon 2 To Exon 3 (Pair 17)
Forward (1140,22)GACAGTTTGCTCGATGGTTATGAmplicon SizecDNA: 100 bpgenomic: 13,829
Reverse (1239,21)CAGGTCCAAAGCTGGTGACATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.88 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACA
GAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)100170 - 269
NM_001204266 (GABRA4)100170 - 269
NM_000809 (GABRA4)1001140 - 1239
Exon 2 To Exon 4 (Pair 35)
Forward (1138,22)TGGACAGTTTGCTCGATGGTTAAmplicon SizecDNA: 294 bpgenomic: 15,423
Reverse (1431,24)TATTTGGAGCTGTCATATTATGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.828 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTA
CAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGG
AATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACG
GCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATA
CTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)294168 - 461
NM_001204266 (GABRA4)294168 - 461
NM_000809 (GABRA4)2941138 - 1431
Exon 2 To Exon 4 (Pair 34)
Forward (1135,21)TCCTGGACAGTTTGCTCGATGAmplicon SizecDNA: 300 bpgenomic: 15,429
Reverse (1434,24)GCTTATTTGGAGCTGTCATATTATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops0.972 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceTCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTG
TTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAA
TGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATG
ACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTG
ATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAATAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)300165 - 464
NM_001204266 (GABRA4)300165 - 464
NM_000809 (GABRA4)3001135 - 1434
Exon 2 To Exon 3 (Pair 16)
Forward (1137,21)CTGGACAGTTTGCTCGATGGTAmplicon SizecDNA: 101 bpgenomic: 13,830
Reverse (1237,22)GGTCCAAAGCTGGTGACATATANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTT
ACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)101167 - 267
NM_000809 (GABRA4)1011137 - 1237
NM_001204266 (GABRA4)101167 - 267
Exon 2 To Exon 4 (Pair 33)
Forward (1138,22)TGGACAGTTTGCTCGATGGTTAAmplicon SizecDNA: 283 bpgenomic: 15,412
Reverse (1420,24)GTCATATTATGTGAGACAGATTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.476 kcal/mol
Reverse Dimers-0.694 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTA
CAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGG
AATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACG
GCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATA
CTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)283168 - 450
NM_000809 (GABRA4)2831138 - 1420
NM_001204266 (GABRA4)283168 - 450
Exon 2 To Exon 4 (Pair 32)
Forward (1135,21)TCCTGGACAGTTTGCTCGATGAmplicon SizecDNA: 294 bpgenomic: 15,423
Reverse (1428,23)TTGGAGCTGTCATATTATGTGAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceTCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTG
TTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAA
TGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATG
ACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTG
ATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)2941135 - 1428
NM_001204266 (GABRA4)294165 - 458
NM_001204267 (GABRA4)294165 - 458
Exon 2 To Exon 4 (Pair 31)
Forward (1137,21)CTGGACAGTTTGCTCGATGGTAmplicon SizecDNA: 297 bpgenomic: 15,426
Reverse (1433,24)CTTATTTGGAGCTGTCATATTATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.828 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTT
ACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATG
GAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGAC
GGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGAT
ACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAATAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)2971137 - 1433
NM_001204266 (GABRA4)297167 - 463
NM_001204267 (GABRA4)297167 - 463
Exon 2 To Exon 4 (Pair 30)
Forward (1140,22)GACAGTTTGCTCGATGGTTATGAmplicon SizecDNA: 275 bpgenomic: 15,404
Reverse (1414,24)TTATGTGAGACAGATTTCTTTCCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.289 kcal/mol
Reverse Dimers-0.694 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACA
GAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGAA
TACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGGC
CCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATACT
TTCTTCAGGAATGGAAAGAAATCTGTCTCACATAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)275170 - 444
NM_000809 (GABRA4)2751140 - 1414
NM_001204266 (GABRA4)275170 - 444
Exon 2 To Exon 4 (Pair 29)
Forward (1142,22)CAGTTTGCTCGATGGTTATGACAmplicon SizecDNA: 290 bpgenomic: 15,419
Reverse (1431,24)TATTTGGAGCTGTCATATTATGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.828 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.902 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACAGA
AGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGAATA
CACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGGCCC
CATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATACTTT
CTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)2901142 - 1431
NM_001204266 (GABRA4)290172 - 461
NM_001204267 (GABRA4)290172 - 461
Exon 2 To Exon 4 (Pair 27)
Forward (1137,21)CTGGACAGTTTGCTCGATGGTAmplicon SizecDNA: 284 bpgenomic: 15,413
Reverse (1420,24)GTCATATTATGTGAGACAGATTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.476 kcal/mol
Reverse Dimers-0.694 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTT
ACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATG
GAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGAC
GGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGAT
ACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)284167 - 450
NM_000809 (GABRA4)2841137 - 1420
NM_001204266 (GABRA4)284167 - 450
Exon 2 To Exon 4 (Pair 28)
Forward (1137,21)CTGGACAGTTTGCTCGATGGTAmplicon SizecDNA: 294 bpgenomic: 15,423
Reverse (1430,24)ATTTGGAGCTGTCATATTATGTGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTT
ACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATG
GAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGAC
GGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGAT
ACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)294167 - 460
NM_000809 (GABRA4)2941137 - 1430
NM_001204266 (GABRA4)294167 - 460
Exon 2 To Exon 4 (Pair 26)
Forward (1139,22)GGACAGTTTGCTCGATGGTTATAmplicon SizecDNA: 277 bpgenomic: 15,406
Reverse (1415,24)ATTATGTGAGACAGATTTCTTTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.289 kcal/mol in 3' area
Reverse Dimers-0.694 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTAC
AGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGA
ATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGG
CCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATAC
TTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)277169 - 445
NM_000809 (GABRA4)2771139 - 1415
NM_001204266 (GABRA4)277169 - 445
Exon 2 To Exon 4 (Pair 25)
Forward (1135,21)TCCTGGACAGTTTGCTCGATGAmplicon SizecDNA: 291 bpgenomic: 15,420
Reverse (1425,23)GAGCTGTCATATTATGTGAGACANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.24 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceTCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTG
TTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAA
TGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATG
ACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTG
ATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)291165 - 455
NM_001204266 (GABRA4)291165 - 455
NM_000809 (GABRA4)2911135 - 1425
Exon 2 To Exon 3 (Pair 15)
Forward (1142,22)CAGTTTGCTCGATGGTTATGACAmplicon SizecDNA: 100 bpgenomic: 13,829
Reverse (1241,21)AACAGGTCCAAAGCTGGTGACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.947 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.88 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceCAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACAGA
AGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)1001142 - 1241
NM_001204266 (GABRA4)100172 - 271
NM_001204267 (GABRA4)100172 - 271
Exon 2 To Exon 3 (Pair 14)
Forward (1135,21)TCCTGGACAGTTTGCTCGATGAmplicon SizecDNA: 104 bpgenomic: 13,833
Reverse (1238,22)AGGTCCAAAGCTGGTGACATATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceTCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTG
TTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)104165 - 268
NM_000809 (GABRA4)1041135 - 1238
NM_001204266 (GABRA4)104165 - 268
Exon 2 To Exon 3 (Pair 13)
Forward (1139,22)GGACAGTTTGCTCGATGGTTATAmplicon SizecDNA: 99 bpgenomic: 13,828
Reverse (1237,22)GGTCCAAAGCTGGTGACATATANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.01 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTAC
AGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)99169 - 267
NM_000809 (GABRA4)991139 - 1237
NM_001204266 (GABRA4)99169 - 267
Exon 2 To Exon 4 (Pair 24)
Forward (1133,21)CATCCTGGACAGTTTGCTCGAAmplicon SizecDNA: 296 bpgenomic: 15,425
Reverse (1428,23)TTGGAGCTGTCATATTATGTGAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol in 3' area
Forward Dimers-1.922 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCATCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCC
TGTTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGA
AATGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATA
TGACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCC
TGATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)296163 - 458
NM_000809 (GABRA4)2961133 - 1428
NM_001204267 (GABRA4)296163 - 458
Exon 2 To Exon 3 (Pair 12)
Forward (1140,22)GACAGTTTGCTCGATGGTTATGAmplicon SizecDNA: 102 bpgenomic: 13,831
Reverse (1241,21)AACAGGTCCAAAGCTGGTGACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.947 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.88 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACA
GAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)1021140 - 1241
NM_001204266 (GABRA4)102170 - 271
NM_001204267 (GABRA4)102170 - 271
Exon 2 To Exon 3 (Pair 11)
Forward (1138,22)TGGACAGTTTGCTCGATGGTTAAmplicon SizecDNA: 101 bpgenomic: 13,830
Reverse (1238,22)AGGTCCAAAGCTGGTGACATATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTA
CAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)101168 - 268
NM_000809 (GABRA4)1011138 - 1238
NM_001204267 (GABRA4)101168 - 268
Exon 2 To Exon 3 (Pair 10)
Forward (1138,22)TGGACAGTTTGCTCGATGGTTAAmplicon SizecDNA: 100 bpgenomic: 13,829
Reverse (1237,22)GGTCCAAAGCTGGTGACATATANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTA
CAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)100168 - 267
NM_001204266 (GABRA4)100168 - 267
NM_000809 (GABRA4)1001138 - 1237
Exon 2 To Exon 4 (Pair 23)
Forward (1133,21)CATCCTGGACAGTTTGCTCGAAmplicon SizecDNA: 295 bpgenomic: 15,424
Reverse (1427,23)TGGAGCTGTCATATTATGTGAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol in 3' area
Forward Dimers-1.922 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCATCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCC
TGTTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGA
AATGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATA
TGACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCC
TGATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)295163 - 457
NM_000809 (GABRA4)2951133 - 1427
NM_001204267 (GABRA4)295163 - 457
Exon 2 To Exon 4 (Pair 22)
Forward (1135,21)TCCTGGACAGTTTGCTCGATGAmplicon SizecDNA: 297 bpgenomic: 15,426
Reverse (1431,24)TATTTGGAGCTGTCATATTATGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.828 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceTCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTG
TTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAA
TGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATG
ACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTG
ATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)297165 - 461
NM_000809 (GABRA4)2971135 - 1431
NM_001204266 (GABRA4)297165 - 461
Exon 2 To Exon 4 (Pair 21)
Forward (1137,21)CTGGACAGTTTGCTCGATGGTAmplicon SizecDNA: 292 bpgenomic: 15,421
Reverse (1428,23)TTGGAGCTGTCATATTATGTGAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTT
ACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATG
GAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGAC
GGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGAT
ACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)292167 - 458
NM_001204266 (GABRA4)292167 - 458
NM_000809 (GABRA4)2921137 - 1428
Exon 2 To Exon 3 (Pair 9)
Forward (1139,22)GGACAGTTTGCTCGATGGTTATAmplicon SizecDNA: 111 bpgenomic: 13,840
Reverse (1249,22)ACATCAGAAACAGGTCCAAAGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops2.483 kcal/mol
Reverse Dimers-0.256 kcal/mol
Forward-Reverse Dimers-2.147 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTAC
AGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)111169 - 279
NM_000809 (GABRA4)1111139 - 1249
NM_001204267 (GABRA4)111169 - 279
Exon 2 To Exon 4 (Pair 20)
Forward (1135,21)TCCTGGACAGTTTGCTCGATGAmplicon SizecDNA: 281 bpgenomic: 15,410
Reverse (1415,24)ATTATGTGAGACAGATTTCTTTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.289 kcal/mol in 3' area
Reverse Dimers-0.694 kcal/mol
Forward-Reverse Dimers-1.273 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceTCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTG
TTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAA
TGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATG
ACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTG
ATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)281165 - 445
NM_000809 (GABRA4)2811135 - 1415
NM_001204267 (GABRA4)281165 - 445
Exon 2 To Exon 4 (Pair 19)
Forward (1139,22)GGACAGTTTGCTCGATGGTTATAmplicon SizecDNA: 296 bpgenomic: 15,425
Reverse (1434,24)GCTTATTTGGAGCTGTCATATTATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.972 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTAC
AGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGA
ATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGG
CCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATAC
TTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAATAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)2961139 - 1434
NM_001204266 (GABRA4)296169 - 464
NM_001204267 (GABRA4)296169 - 464
Exon 2 To Exon 4 (Pair 18)
Forward (1135,21)TCCTGGACAGTTTGCTCGATGAmplicon SizecDNA: 296 bpgenomic: 15,425
Reverse (1430,24)ATTTGGAGCTGTCATATTATGTGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceTCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTG
TTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAA
TGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATG
ACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTG
ATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)296165 - 460
NM_000809 (GABRA4)2961135 - 1430
NM_001204266 (GABRA4)296165 - 460
Exon 2 To Exon 4 (Pair 17)
Forward (1137,21)CTGGACAGTTTGCTCGATGGTAmplicon SizecDNA: 279 bpgenomic: 15,408
Reverse (1415,24)ATTATGTGAGACAGATTTCTTTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.289 kcal/mol in 3' area
Reverse Dimers-0.694 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTT
ACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATG
GAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGAC
GGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGAT
ACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000809 (GABRA4)2791137 - 1415
NM_001204266 (GABRA4)279167 - 445
NM_001204267 (GABRA4)279167 - 445
Exon 2 To Exon 4 (Pair 16)
Forward (1133,21)CATCCTGGACAGTTTGCTCGAAmplicon SizecDNA: 298 bpgenomic: 15,427
Reverse (1430,24)ATTTGGAGCTGTCATATTATGTGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol in 3' area
Forward Dimers-1.922 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCATCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCC
TGTTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGA
AATGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATA
TGACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCC
TGATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)298163 - 460
NM_000809 (GABRA4)2981133 - 1430
NM_001204266 (GABRA4)298163 - 460
Exon 2 To Exon 3 (Pair 8)
Forward (1142,22)CAGTTTGCTCGATGGTTATGACAmplicon SizecDNA: 96 bpgenomic: 13,825
Reverse (1237,22)GGTCCAAAGCTGGTGACATATANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.88 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceCAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACAGA
AGTGAAAACTGACATATATGTCACCAGCTTTGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)96172 - 267
NM_000809 (GABRA4)961142 - 1237
NM_001204266 (GABRA4)96172 - 267
Exon 2 To Exon 4 (Pair 15)
Forward (1140,22)GACAGTTTGCTCGATGGTTATGAmplicon SizecDNA: 288 bpgenomic: 15,417
Reverse (1427,23)TGGAGCTGTCATATTATGTGAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.32 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACA
GAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGAA
TACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGGC
CCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATACT
TTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)288170 - 457
NM_000809 (GABRA4)2881140 - 1427
NM_001204266 (GABRA4)288170 - 457
Exon 2 To Exon 4 (Pair 14)
Forward (1138,22)TGGACAGTTTGCTCGATGGTTAAmplicon SizecDNA: 291 bpgenomic: 15,420
Reverse (1428,23)TTGGAGCTGTCATATTATGTGAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTA
CAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGG
AATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACG
GCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATA
CTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)291168 - 458
NM_000809 (GABRA4)2911138 - 1428
NM_001204267 (GABRA4)291168 - 458
Exon 2 To Exon 3 (Pair 7)
Forward (1140,22)GACAGTTTGCTCGATGGTTATGAmplicon SizecDNA: 101 bpgenomic: 13,830
Reverse (1240,21)ACAGGTCCAAAGCTGGTGACANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.88 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACA
GAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)101170 - 270
NM_001204266 (GABRA4)101170 - 270
NM_000809 (GABRA4)1011140 - 1240
Exon 2 To Exon 4 (Pair 13)
Forward (1133,21)CATCCTGGACAGTTTGCTCGAAmplicon SizecDNA: 293 bpgenomic: 15,422
Reverse (1425,23)GAGCTGTCATATTATGTGAGACANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol in 3' area
Forward Dimers-1.922 kcal/mol
Reverse Loops1.24 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCATCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCC
TGTTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGA
AATGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATA
TGACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCC
TGATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)293163 - 455
NM_001204266 (GABRA4)293163 - 455
NM_000809 (GABRA4)2931133 - 1425
Exon 2 To Exon 4 (Pair 12)
Forward (1142,22)CAGTTTGCTCGATGGTTATGACAmplicon SizecDNA: 286 bpgenomic: 15,415
Reverse (1427,23)TGGAGCTGTCATATTATGTGAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.902 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACAGA
AGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGAATA
CACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGGCCC
CATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATACTTT
CTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)286172 - 457
NM_000809 (GABRA4)2861142 - 1427
NM_001204266 (GABRA4)286172 - 457
Exon 2 To Exon 4 (Pair 11)
Forward (1135,21)TCCTGGACAGTTTGCTCGATGAmplicon SizecDNA: 293 bpgenomic: 15,422
Reverse (1427,23)TGGAGCTGTCATATTATGTGAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceTCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTG
TTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAA
TGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATG
ACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTG
ATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)293165 - 457
NM_001204266 (GABRA4)293165 - 457
NM_000809 (GABRA4)2931135 - 1427
Exon 2 To Exon 4 (Pair 10)
Forward (1142,22)CAGTTTGCTCGATGGTTATGACAmplicon SizecDNA: 273 bpgenomic: 15,402
Reverse (1414,24)TTATGTGAGACAGATTTCTTTCCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.289 kcal/mol
Reverse Dimers-0.694 kcal/mol
Forward-Reverse Dimers-1.117 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTACAGA
AGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGAATA
CACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGGCCC
CATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATACTTT
CTTCAGGAATGGAAAGAAATCTGTCTCACATAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)273172 - 444
NM_000809 (GABRA4)2731142 - 1414
NM_001204267 (GABRA4)273172 - 444
Exon 2 To Exon 4 (Pair 9)
Forward (1138,22)TGGACAGTTTGCTCGATGGTTAAmplicon SizecDNA: 297 bpgenomic: 15,426
Reverse (1434,24)GCTTATTTGGAGCTGTCATATTATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.972 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTA
CAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGG
AATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACG
GCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATA
CTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAATAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)297168 - 464
NM_000809 (GABRA4)2971138 - 1434
NM_001204267 (GABRA4)297168 - 464
Exon 2 To Exon 4 (Pair 8)
Forward (1137,21)CTGGACAGTTTGCTCGATGGTAmplicon SizecDNA: 291 bpgenomic: 15,420
Reverse (1427,23)TGGAGCTGTCATATTATGTGAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.482 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.597 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTT
ACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATG
GAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGAC
GGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGAT
ACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATGACAGCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)291167 - 457
NM_001204266 (GABRA4)291167 - 457
NM_000809 (GABRA4)2911137 - 1427
Exon 2 To Exon 4 (Pair 7)
Forward (1139,22)GGACAGTTTGCTCGATGGTTATAmplicon SizecDNA: 276 bpgenomic: 15,405
Reverse (1414,24)TTATGTGAGACAGATTTCTTTCCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.289 kcal/mol
Reverse Dimers-0.694 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-2.498 kcal/mol outside primersite
Amplicon SequenceGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTAC
AGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTTGAAATGGA
ATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGG
CCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATAC
TTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204267 (GABRA4)276169 - 444
NM_000809 (GABRA4)2761139 - 1414
NM_001204266 (GABRA4)276169 - 444
Exon 2 To Exon 3 (Pair 6)
Forward (1138,22)TGGACAGTTTGCTCGATGGTTAAmplicon SizecDNA: 102 bpgenomic: 13,831
Reverse (1239,21)CAGGTCCAAAGCTGGTGACATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.281 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.889 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.776 kcal/mol outside primersite
Amplicon SequenceTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGGATTTGGGGGTCCTGTTA
CAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204266 (GABRA4)102168 - 269
NM_000809 (GABRA4)1021138 - 1239
NM_001204267 (GABRA4)102168 - 269
 

See below for some more details.

Program Output:

Loading ...