Design Results for gja1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 2 (Pair 1)
Forward (193,22)AGTTCAATCACTTGGCGTGACTAmplicon SizecDNA: 145 bpgenomic: 11,144
Reverse (337,21)AGTACTGACAGCCACACCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol in 3' area
Forward Dimers-0.787 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-1.778 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACA
TGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTG
GAGGGAAGGTGTGGCTGTCAGTACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)145192 - 336
Exon 1 To Exon 2 (Pair 2)
Forward (148,21)CTGAGTGCCTGAACTTGCCTTAmplicon SizecDNA: 192 bpgenomic: 11,191
Reverse (339,22)AAAGTACTGACAGCCACACCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.981 kcal/mol
Forward Dimers-1.309 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-2.86 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGG
CGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCG
CCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGC
TGTCAGTACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)192147 - 338
Exon 1 To Exon 2 (Pair 3)
Forward (143,21)CAGGTCTGAGTGCCTGAACTTAmplicon SizecDNA: 188 bpgenomic: 11,187
Reverse (330,20)ACAGCCACACCTTCCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.028 kcal/mol
Forward Dimers-1.87 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCAGGTCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCA
CTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTG
GAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGT
GTGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)188142 - 329
Exon 1 To Exon 2 (Pair 4)
Forward (193,22)AGTTCAATCACTTGGCGTGACTAmplicon SizecDNA: 138 bpgenomic: 11,137
Reverse (330,20)ACAGCCACACCTTCCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol in 3' area
Forward Dimers-0.787 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACA
TGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTG
GAGGGAAGGTGTGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)138192 - 329
Exon 1 To Exon 2 (Pair 5)
Forward (199,22)ATCACTTGGCGTGACTTCACTAAmplicon SizecDNA: 135 bpgenomic: 11,134
Reverse (333,20)CTGACAGCCACACCTTCCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol
Forward Dimers-0.595 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers-0.653 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTG
ACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGA
AGGTGTGGCTGTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)135198 - 332
Exon 1 To Exon 2 (Pair 6)
Forward (147,21)TCTGAGTGCCTGAACTTGCCTAmplicon SizecDNA: 186 bpgenomic: 11,185
Reverse (332,20)TGACAGCCACACCTTCCCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.981 kcal/mol
Forward Dimers-1.309 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTG
GCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGC
GCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGG
CTGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)186146 - 331
Exon 1 To Exon 2 (Pair 7)
Forward (98,22)TGAGGAAAGTACCAAACAGCAGAmplicon SizecDNA: 224 bpgenomic: 11,223
Reverse (321,20)CCTTCCCTCCAGCAGTTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.471 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops1.317 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.905 kcal/mol outside primersite
Amplicon SequenceTGAGGAAAGTACCAAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCCT
GAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCA
CTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAA
ACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)22497 - 320
Exon 1 To Exon 2 (Pair 8)
Forward (178,22)CTTCATCCTCCAAGGAGTTCAAAmplicon SizecDNA: 162 bpgenomic: 11,161
Reverse (339,22)AAAGTACTGACAGCCACACCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-2.86 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGT
GGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAG
CCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)162177 - 338
Exon 1 To Exon 2 (Pair 9)
Forward (199,22)ATCACTTGGCGTGACTTCACTAAmplicon SizecDNA: 139 bpgenomic: 11,138
Reverse (337,21)AGTACTGACAGCCACACCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol
Forward Dimers-0.595 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-1.778 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTG
ACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGA
AGGTGTGGCTGTCAGTACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)139198 - 336
Exon 1 To Exon 2 (Pair 10)
Forward (196,22)TCAATCACTTGGCGTGACTTCAAmplicon SizecDNA: 128 bpgenomic: 11,127
Reverse (323,20)CACCTTCCCTCCAGCAGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol
Forward Dimers-0.595 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGG
GTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAG
GGAAGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)128195 - 322
Exon 1 To Exon 2 (Pair 11)
Forward (180,22)TCATCCTCCAAGGAGTTCAATCAmplicon SizecDNA: 154 bpgenomic: 11,153
Reverse (333,20)CTGACAGCCACACCTTCCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers-0.653 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGG
TGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCC
TACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)154179 - 332
Exon 1 To Exon 2 (Pair 12)
Forward (183,22)TCCTCCAAGGAGTTCAATCACTAmplicon SizecDNA: 157 bpgenomic: 11,156
Reverse (339,22)AAAGTACTGACAGCCACACCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.441 kcal/mol
Forward Dimers-1.819 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-2.86 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGC
CCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTAC
TCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)157182 - 338
Exon 1 To Exon 2 (Pair 13)
Forward (177,22)ACTTCATCCTCCAAGGAGTTCAAmplicon SizecDNA: 188 bpgenomic: 11,187
Reverse (364,20)CCCAGCAGCAGGATTCGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.39 kcal/mol
Reverse Dimers-2.038 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAG
TGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAA
GCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTTTCATTTTCCGAATCCTG
CTGCTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)188176 - 363
Exon 1 To Exon 2 (Pair 14)
Forward (198,22)AATCACTTGGCGTGACTTCACTAmplicon SizecDNA: 124 bpgenomic: 11,123
Reverse (321,20)CCTTCCCTCCAGCAGTTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol
Forward Dimers-0.595 kcal/mol
Reverse Loops1.317 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGT
GACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGG
AAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)124197 - 320
Exon 1 To Exon 2 (Pair 15)
Forward (193,22)AGTTCAATCACTTGGCGTGACTAmplicon SizecDNA: 129 bpgenomic: 11,128
Reverse (321,20)CCTTCCCTCCAGCAGTTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol in 3' area
Forward Dimers-0.787 kcal/mol
Reverse Loops1.317 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACA
TGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTG
GAGGGAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)129192 - 320
Exon 1 To Exon 2 (Pair 16)
Forward (178,22)CTTCATCCTCCAAGGAGTTCAAAmplicon SizecDNA: 144 bpgenomic: 11,143
Reverse (321,20)CCTTCCCTCCAGCAGTTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.317 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGT
GGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAG
CCTACTCAACTGCTGGAGGGAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)144177 - 320
Exon 1 To Exon 2 (Pair 17)
Forward (191,21)GGAGTTCAATCACTTGGCGTGAmplicon SizecDNA: 143 bpgenomic: 11,142
Reverse (333,20)CTGACAGCCACACCTTCCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol in 3' area
Forward Dimers-1.35 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers-0.653 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAA
CATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGC
TGGAGGGAAGGTGTGGCTGTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)143190 - 332
Exon 1 To Exon 2 (Pair 18)
Forward (203,22)CTTGGCGTGACTTCACTACTTTAmplicon SizecDNA: 131 bpgenomic: 11,130
Reverse (333,20)CTGACAGCCACACCTTCCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.167 kcal/mol
Forward Dimers-0.53 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers-0.653 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTG
GAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGT
GTGGCTGTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)131202 - 332
Exon 1 To Exon 2 (Pair 19)
Forward (203,22)CTTGGCGTGACTTCACTACTTTAmplicon SizecDNA: 119 bpgenomic: 11,118
Reverse (321,20)CCTTCCCTCCAGCAGTTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.167 kcal/mol
Forward Dimers-0.53 kcal/mol
Reverse Loops1.317 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTG
GAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)119202 - 320
Exon 1 To Exon 2 (Pair 20)
Forward (147,21)TCTGAGTGCCTGAACTTGCCTAmplicon SizecDNA: 193 bpgenomic: 11,192
Reverse (339,22)AAAGTACTGACAGCCACACCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.981 kcal/mol
Forward Dimers-1.309 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-2.86 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTG
GCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGC
GCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGG
CTGTCAGTACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)193146 - 338
Exon 1 To Exon 2 (Pair 21)
Forward (178,22)CTTCATCCTCCAAGGAGTTCAAAmplicon SizecDNA: 157 bpgenomic: 11,156
Reverse (334,20)ACTGACAGCCACACCTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.996 kcal/mol in 3' area
Reverse Dimers-1.358 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGT
GGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAG
CCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)157177 - 333
Exon 1 To Exon 2 (Pair 22)
Forward (202,22)ACTTGGCGTGACTTCACTACTTAmplicon SizecDNA: 129 bpgenomic: 11,128
Reverse (330,20)ACAGCCACACCTTCCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.167 kcal/mol
Forward Dimers-0.53 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACT
GGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGG
TGTGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)129201 - 329
Exon 1 To Exon 2 (Pair 23)
Forward (182,22)ATCCTCCAAGGAGTTCAATCACAmplicon SizecDNA: 153 bpgenomic: 11,152
Reverse (334,20)ACTGACAGCCACACCTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.996 kcal/mol in 3' area
Reverse Dimers-1.358 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTG
CCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTA
CTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)153181 - 333
Exon 1 To Exon 2 (Pair 24)
Forward (97,22)GTGAGGAAAGTACCAAACAGCAAmplicon SizecDNA: 225 bpgenomic: 11,224
Reverse (321,20)CCTTCCCTCCAGCAGTTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.471 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops1.317 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.905 kcal/mol outside primersite
Amplicon SequenceGTGAGGAAAGTACCAAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCC
TGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTC
ACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCA
AACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)22596 - 320
Exon 1 To Exon 2 (Pair 25)
Forward (98,22)TGAGGAAAGTACCAAACAGCAGAmplicon SizecDNA: 233 bpgenomic: 11,232
Reverse (330,20)ACAGCCACACCTTCCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.471 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.905 kcal/mol outside primersite
Amplicon SequenceTGAGGAAAGTACCAAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCCT
GAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCA
CTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAA
ACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)23397 - 329
Exon 1 To Exon 2 (Pair 26)
Forward (177,22)ACTTCATCCTCCAAGGAGTTCAAmplicon SizecDNA: 147 bpgenomic: 11,146
Reverse (323,20)CACCTTCCCTCCAGCAGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAG
TGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAA
GCCTACTCAACTGCTGGAGGGAAGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)147176 - 322
Exon 1 To Exon 2 (Pair 27)
Forward (191,21)GGAGTTCAATCACTTGGCGTGAmplicon SizecDNA: 140 bpgenomic: 11,139
Reverse (330,20)ACAGCCACACCTTCCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol in 3' area
Forward Dimers-1.35 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAA
CATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGC
TGGAGGGAAGGTGTGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)140190 - 329
Exon 1 To Exon 2 (Pair 28)
Forward (191,21)GGAGTTCAATCACTTGGCGTGAmplicon SizecDNA: 137 bpgenomic: 11,136
Reverse (327,19)GCCACACCTTCCCTCCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol in 3' area
Forward Dimers-1.35 kcal/mol
Reverse Loops2.732 kcal/mol in 3' area
Reverse Dimers0.26 kcal/mol in 3' area
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAA
CATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGC
TGGAGGGAAGGTGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)137190 - 326
Exon 1 To Exon 2 (Pair 29)
Forward (202,22)ACTTGGCGTGACTTCACTACTTAmplicon SizecDNA: 136 bpgenomic: 11,135
Reverse (337,21)AGTACTGACAGCCACACCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.167 kcal/mol
Forward Dimers-0.53 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-1.778 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACT
GGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGG
TGTGGCTGTCAGTACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)136201 - 336
Exon 1 To Exon 2 (Pair 30)
Forward (177,22)ACTTCATCCTCCAAGGAGTTCAAmplicon SizecDNA: 157 bpgenomic: 11,156
Reverse (333,20)CTGACAGCCACACCTTCCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers-0.653 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAG
TGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAA
GCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)157176 - 332
Exon 1 To Exon 2 (Pair 31)
Forward (189,22)AAGGAGTTCAATCACTTGGCGTAmplicon SizecDNA: 146 bpgenomic: 11,145
Reverse (334,20)ACTGACAGCCACACCTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.267 kcal/mol
Forward Dimers-1.35 kcal/mol
Reverse Loops1.996 kcal/mol in 3' area
Reverse Dimers-1.358 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGC
AACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACT
GCTGGAGGGAAGGTGTGGCTGTCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)146188 - 333
Exon 1 To Exon 2 (Pair 32)
Forward (102,21)GAAAGTACCAAACAGCAGCGGAmplicon SizecDNA: 236 bpgenomic: 11,235
Reverse (337,21)AGTACTGACAGCCACACCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.471 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-1.778 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.905 kcal/mol outside primersite
Amplicon SequenceGAAAGTACCAAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCCTGAAC
TTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTAC
TTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTC
CTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)236101 - 336
Exon 1 To Exon 2 (Pair 33)
Forward (193,22)AGTTCAATCACTTGGCGTGACTAmplicon SizecDNA: 131 bpgenomic: 11,130
Reverse (323,20)CACCTTCCCTCCAGCAGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol in 3' area
Forward Dimers-0.787 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACA
TGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTG
GAGGGAAGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)131192 - 322
Exon 1 To Exon 2 (Pair 34)
Forward (184,22)CCTCCAAGGAGTTCAATCACTTAmplicon SizecDNA: 147 bpgenomic: 11,146
Reverse (330,20)ACAGCCACACCTTCCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-1.702 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCC
CAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACT
CAACTGCTGGAGGGAAGGTGTGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)147183 - 329
Exon 1 To Exon 2 (Pair 35)
Forward (199,22)ATCACTTGGCGTGACTTCACTAAmplicon SizecDNA: 136 bpgenomic: 11,135
Reverse (334,20)ACTGACAGCCACACCTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol
Forward Dimers-0.595 kcal/mol
Reverse Loops1.996 kcal/mol in 3' area
Reverse Dimers-1.358 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTG
ACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGA
AGGTGTGGCTGTCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)136198 - 333
Exon 1 To Exon 2 (Pair 36)
Forward (178,22)CTTCATCCTCCAAGGAGTTCAAAmplicon SizecDNA: 155 bpgenomic: 11,154
Reverse (332,20)TGACAGCCACACCTTCCCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGT
GGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAG
CCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)155177 - 331
Exon 1 To Exon 2 (Pair 37)
Forward (177,22)ACTTCATCCTCCAAGGAGTTCAAmplicon SizecDNA: 156 bpgenomic: 11,155
Reverse (332,20)TGACAGCCACACCTTCCCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAG
TGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAA
GCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)156176 - 331
Exon 1 To Exon 2 (Pair 38)
Forward (180,22)TCATCCTCCAAGGAGTTCAATCAmplicon SizecDNA: 155 bpgenomic: 11,154
Reverse (334,20)ACTGACAGCCACACCTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.996 kcal/mol in 3' area
Reverse Dimers-1.358 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGG
TGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCC
TACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)155179 - 333
Exon 1 To Exon 2 (Pair 39)
Forward (148,21)CTGAGTGCCTGAACTTGCCTTAmplicon SizecDNA: 183 bpgenomic: 11,182
Reverse (330,20)ACAGCCACACCTTCCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.981 kcal/mol
Forward Dimers-1.309 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGG
CGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCG
CCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGC
TGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)183147 - 329
Exon 1 To Exon 2 (Pair 40)
Forward (182,22)ATCCTCCAAGGAGTTCAATCACAmplicon SizecDNA: 183 bpgenomic: 11,182
Reverse (364,20)CCCAGCAGCAGGATTCGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.39 kcal/mol
Reverse Dimers-2.038 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTG
CCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTA
CTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGCTGCT
GGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)183181 - 363
Exon 1 To Exon 2 (Pair 41)
Forward (180,22)TCATCCTCCAAGGAGTTCAATCAmplicon SizecDNA: 160 bpgenomic: 11,159
Reverse (339,22)AAAGTACTGACAGCCACACCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-2.86 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGG
TGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCC
TACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)160179 - 338
Exon 1 To Exon 2 (Pair 42)
Forward (199,22)ATCACTTGGCGTGACTTCACTAAmplicon SizecDNA: 129 bpgenomic: 11,128
Reverse (327,19)GCCACACCTTCCCTCCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol
Forward Dimers-0.595 kcal/mol
Reverse Loops2.732 kcal/mol in 3' area
Reverse Dimers0.26 kcal/mol in 3' area
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTG
ACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGA
AGGTGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)129198 - 326
Exon 1 To Exon 2 (Pair 43)
Forward (181,22)CATCCTCCAAGGAGTTCAATCAAmplicon SizecDNA: 159 bpgenomic: 11,158
Reverse (339,22)AAAGTACTGACAGCCACACCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-2.86 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGT
GCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCT
ACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)159180 - 338
Exon 1 To Exon 2 (Pair 44)
Forward (182,22)ATCCTCCAAGGAGTTCAATCACAmplicon SizecDNA: 151 bpgenomic: 11,150
Reverse (332,20)TGACAGCCACACCTTCCCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTG
CCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTA
CTCAACTGCTGGAGGGAAGGTGTGGCTGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)151181 - 331
Exon 1 To Exon 2 (Pair 45)
Forward (196,22)TCAATCACTTGGCGTGACTTCAAmplicon SizecDNA: 135 bpgenomic: 11,134
Reverse (330,20)ACAGCCACACCTTCCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol
Forward Dimers-0.595 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGG
GTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAG
GGAAGGTGTGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)135195 - 329
Exon 1 To Exon 2 (Pair 46)
Forward (183,22)TCCTCCAAGGAGTTCAATCACTAmplicon SizecDNA: 139 bpgenomic: 11,138
Reverse (321,20)CCTTCCCTCCAGCAGTTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.441 kcal/mol
Forward Dimers-1.819 kcal/mol
Reverse Loops1.317 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGC
CCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTAC
TCAACTGCTGGAGGGAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)139182 - 320
Exon 1 To Exon 2 (Pair 47)
Forward (143,21)CAGGTCTGAGTGCCTGAACTTAmplicon SizecDNA: 191 bpgenomic: 11,190
Reverse (333,20)CTGACAGCCACACCTTCCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.028 kcal/mol
Forward Dimers-1.87 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers-0.653 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCAGGTCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCA
CTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTG
GAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGT
GTGGCTGTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)191142 - 332
Exon 1 To Exon 2 (Pair 48)
Forward (143,21)CAGGTCTGAGTGCCTGAACTTAmplicon SizecDNA: 181 bpgenomic: 11,180
Reverse (323,20)CACCTTCCCTCCAGCAGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.028 kcal/mol
Forward Dimers-1.87 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCAGGTCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCA
CTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTG
GAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGT
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)181142 - 322
Exon 1 To Exon 2 (Pair 49)
Forward (189,22)AAGGAGTTCAATCACTTGGCGTAmplicon SizecDNA: 133 bpgenomic: 11,132
Reverse (321,20)CCTTCCCTCCAGCAGTTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.267 kcal/mol
Forward Dimers-1.35 kcal/mol
Reverse Loops1.317 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGC
AACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACT
GCTGGAGGGAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)133188 - 320
Exon 1 To Exon 2 (Pair 50)
Forward (184,22)CCTCCAAGGAGTTCAATCACTTAmplicon SizecDNA: 138 bpgenomic: 11,137
Reverse (321,20)CCTTCCCTCCAGCAGTTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-1.702 kcal/mol
Reverse Loops1.317 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCC
CAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACT
CAACTGCTGGAGGGAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)138183 - 320
Exon 1 To Exon 2 (Pair 51)
Forward (178,22)CTTCATCCTCCAAGGAGTTCAAAmplicon SizecDNA: 153 bpgenomic: 11,152
Reverse (330,20)ACAGCCACACCTTCCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGT
GGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAG
CCTACTCAACTGCTGGAGGGAAGGTGTGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)153177 - 329
Exon 1 To Exon 2 (Pair 52)
Forward (202,22)ACTTGGCGTGACTTCACTACTTAmplicon SizecDNA: 138 bpgenomic: 11,137
Reverse (339,22)AAAGTACTGACAGCCACACCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.167 kcal/mol
Forward Dimers-0.53 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-2.86 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACT
GGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGG
TGTGGCTGTCAGTACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)138201 - 338
Exon 1 To Exon 2 (Pair 53)
Forward (181,22)CATCCTCCAAGGAGTTCAATCAAmplicon SizecDNA: 150 bpgenomic: 11,149
Reverse (330,20)ACAGCCACACCTTCCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGT
GCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCT
ACTCAACTGCTGGAGGGAAGGTGTGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)150180 - 329
Exon 1 To Exon 2 (Pair 54)
Forward (203,22)CTTGGCGTGACTTCACTACTTTAmplicon SizecDNA: 162 bpgenomic: 11,161
Reverse (364,20)CCCAGCAGCAGGATTCGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.167 kcal/mol
Forward Dimers-0.53 kcal/mol
Reverse Loops1.39 kcal/mol
Reverse Dimers-2.038 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTG
GAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGT
GTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGCTGCTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)162202 - 363
Exon 1 To Exon 2 (Pair 55)
Forward (102,21)GAAAGTACCAAACAGCAGCGGAmplicon SizecDNA: 233 bpgenomic: 11,232
Reverse (334,20)ACTGACAGCCACACCTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.471 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.996 kcal/mol in 3' area
Reverse Dimers-1.358 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.905 kcal/mol outside primersite
Amplicon SequenceGAAAGTACCAAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCCTGAAC
TTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTAC
TTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTC
CTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)233101 - 333
Exon 1 To Exon 2 (Pair 56)
Forward (184,22)CCTCCAAGGAGTTCAATCACTTAmplicon SizecDNA: 156 bpgenomic: 11,155
Reverse (339,22)AAAGTACTGACAGCCACACCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-1.702 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-2.86 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCC
CAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACT
CAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)156183 - 338
Exon 1 To Exon 2 (Pair 57)
Forward (181,22)CATCCTCCAAGGAGTTCAATCAAmplicon SizecDNA: 143 bpgenomic: 11,142
Reverse (323,20)CACCTTCCCTCCAGCAGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGT
GCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCT
ACTCAACTGCTGGAGGGAAGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)143180 - 322
Exon 1 To Exon 2 (Pair 58)
Forward (178,22)CTTCATCCTCCAAGGAGTTCAAAmplicon SizecDNA: 156 bpgenomic: 11,155
Reverse (333,20)CTGACAGCCACACCTTCCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers-0.653 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGT
GGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAG
CCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)156177 - 332
Exon 1 To Exon 2 (Pair 59)
Forward (97,22)GTGAGGAAAGTACCAAACAGCAAmplicon SizecDNA: 231 bpgenomic: 11,230
Reverse (327,19)GCCACACCTTCCCTCCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.471 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops2.732 kcal/mol in 3' area
Reverse Dimers0.26 kcal/mol in 3' area
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.905 kcal/mol outside primersite
Amplicon SequenceGTGAGGAAAGTACCAAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCC
TGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTC
ACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCA
AACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)23196 - 326
Exon 1 To Exon 2 (Pair 60)
Forward (147,21)TCTGAGTGCCTGAACTTGCCTAmplicon SizecDNA: 187 bpgenomic: 11,186
Reverse (333,20)CTGACAGCCACACCTTCCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.981 kcal/mol
Forward Dimers-1.309 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers-0.653 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTG
GCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGC
GCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGG
CTGTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)187146 - 332
Exon 1 To Exon 2 (Pair 61)
Forward (180,22)TCATCCTCCAAGGAGTTCAATCAmplicon SizecDNA: 144 bpgenomic: 11,143
Reverse (323,20)CACCTTCCCTCCAGCAGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGG
TGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCC
TACTCAACTGCTGGAGGGAAGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)144179 - 322
Exon 1 To Exon 2 (Pair 62)
Forward (202,22)ACTTGGCGTGACTTCACTACTTAmplicon SizecDNA: 131 bpgenomic: 11,130
Reverse (332,20)TGACAGCCACACCTTCCCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.167 kcal/mol
Forward Dimers-0.53 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACT
GGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGG
TGTGGCTGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)131201 - 331
Exon 1 To Exon 2 (Pair 63)
Forward (148,21)CTGAGTGCCTGAACTTGCCTTAmplicon SizecDNA: 190 bpgenomic: 11,189
Reverse (337,21)AGTACTGACAGCCACACCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.981 kcal/mol
Forward Dimers-1.309 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-1.778 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGG
CGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCG
CCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGC
TGTCAGTACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)190147 - 336
Exon 1 To Exon 2 (Pair 64)
Forward (199,22)ATCACTTGGCGTGACTTCACTAAmplicon SizecDNA: 141 bpgenomic: 11,140
Reverse (339,22)AAAGTACTGACAGCCACACCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol
Forward Dimers-0.595 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-2.86 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTG
ACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGA
AGGTGTGGCTGTCAGTACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)141198 - 338
Exon 1 To Exon 2 (Pair 65)
Forward (203,22)CTTGGCGTGACTTCACTACTTTAmplicon SizecDNA: 132 bpgenomic: 11,131
Reverse (334,20)ACTGACAGCCACACCTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.167 kcal/mol
Forward Dimers-0.53 kcal/mol
Reverse Loops1.996 kcal/mol in 3' area
Reverse Dimers-1.358 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTG
GAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGT
GTGGCTGTCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)132202 - 333
Exon 1 To Exon 2 (Pair 66)
Forward (199,22)ATCACTTGGCGTGACTTCACTAAmplicon SizecDNA: 166 bpgenomic: 11,165
Reverse (364,20)CCCAGCAGCAGGATTCGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol
Forward Dimers-0.595 kcal/mol
Reverse Loops1.39 kcal/mol
Reverse Dimers-2.038 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTG
ACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGA
AGGTGTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGCTGCTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)166198 - 363
Exon 1 To Exon 2 (Pair 67)
Forward (199,22)ATCACTTGGCGTGACTTCACTAAmplicon SizecDNA: 125 bpgenomic: 11,124
Reverse (323,20)CACCTTCCCTCCAGCAGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol
Forward Dimers-0.595 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTG
ACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGA
AGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)125198 - 322
Exon 1 To Exon 2 (Pair 68)
Forward (97,22)GTGAGGAAAGTACCAAACAGCAAmplicon SizecDNA: 236 bpgenomic: 11,235
Reverse (332,20)TGACAGCCACACCTTCCCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.471 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.905 kcal/mol outside primersite
Amplicon SequenceGTGAGGAAAGTACCAAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCC
TGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTC
ACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCA
AACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)23696 - 331
Exon 1 To Exon 2 (Pair 69)
Forward (196,22)TCAATCACTTGGCGTGACTTCAAmplicon SizecDNA: 142 bpgenomic: 11,141
Reverse (337,21)AGTACTGACAGCCACACCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol
Forward Dimers-0.595 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-1.778 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGG
GTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAG
GGAAGGTGTGGCTGTCAGTACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)142195 - 336
Exon 1 To Exon 2 (Pair 70)
Forward (147,21)TCTGAGTGCCTGAACTTGCCTAmplicon SizecDNA: 188 bpgenomic: 11,187
Reverse (334,20)ACTGACAGCCACACCTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.981 kcal/mol
Forward Dimers-1.309 kcal/mol
Reverse Loops1.996 kcal/mol in 3' area
Reverse Dimers-1.358 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTG
GCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGC
GCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGG
CTGTCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)188146 - 333
Exon 1 To Exon 2 (Pair 71)
Forward (180,22)TCATCCTCCAAGGAGTTCAATCAmplicon SizecDNA: 185 bpgenomic: 11,184
Reverse (364,20)CCCAGCAGCAGGATTCGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.39 kcal/mol
Reverse Dimers-2.038 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGG
TGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCC
TACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGCTG
CTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)185179 - 363
Exon 1 To Exon 2 (Pair 72)
Forward (148,21)CTGAGTGCCTGAACTTGCCTTAmplicon SizecDNA: 180 bpgenomic: 11,179
Reverse (327,19)GCCACACCTTCCCTCCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.981 kcal/mol
Forward Dimers-1.309 kcal/mol
Reverse Loops2.732 kcal/mol in 3' area
Reverse Dimers0.26 kcal/mol in 3' area
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGG
CGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCG
CCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)180147 - 326
Exon 1 To Exon 2 (Pair 73)
Forward (147,21)TCTGAGTGCCTGAACTTGCCTAmplicon SizecDNA: 191 bpgenomic: 11,190
Reverse (337,21)AGTACTGACAGCCACACCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.981 kcal/mol
Forward Dimers-1.309 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-1.778 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTG
GCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGC
GCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGG
CTGTCAGTACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)191146 - 336
Exon 1 To Exon 2 (Pair 74)
Forward (102,21)GAAAGTACCAAACAGCAGCGGAmplicon SizecDNA: 263 bpgenomic: 11,262
Reverse (364,20)CCCAGCAGCAGGATTCGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.471 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.39 kcal/mol
Reverse Dimers-2.038 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.905 kcal/mol outside primersite
Amplicon SequenceGAAAGTACCAAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCCTGAAC
TTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTAC
TTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTC
CTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTTTC
ATTTTCCGAATCCTGCTGCTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)263101 - 363
Exon 1 To Exon 2 (Pair 75)
Forward (98,22)TGAGGAAAGTACCAAACAGCAGAmplicon SizecDNA: 236 bpgenomic: 11,235
Reverse (333,20)CTGACAGCCACACCTTCCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.471 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers-0.653 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.905 kcal/mol outside primersite
Amplicon SequenceTGAGGAAAGTACCAAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCCT
GAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCA
CTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAA
ACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)23697 - 332
Exon 1 To Exon 2 (Pair 76)
Forward (193,22)AGTTCAATCACTTGGCGTGACTAmplicon SizecDNA: 147 bpgenomic: 11,146
Reverse (339,22)AAAGTACTGACAGCCACACCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol in 3' area
Forward Dimers-0.787 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-2.86 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACA
TGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTG
GAGGGAAGGTGTGGCTGTCAGTACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)147192 - 338
Exon 1 To Exon 2 (Pair 77)
Forward (178,22)CTTCATCCTCCAAGGAGTTCAAAmplicon SizecDNA: 146 bpgenomic: 11,145
Reverse (323,20)CACCTTCCCTCCAGCAGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGT
GGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAG
CCTACTCAACTGCTGGAGGGAAGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)146177 - 322
Exon 1 To Exon 2 (Pair 78)
Forward (181,22)CATCCTCCAAGGAGTTCAATCAAmplicon SizecDNA: 152 bpgenomic: 11,151
Reverse (332,20)TGACAGCCACACCTTCCCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.996 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGT
GCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCT
ACTCAACTGCTGGAGGGAAGGTGTGGCTGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)152180 - 331
Exon 1 To Exon 2 (Pair 79)
Forward (97,22)GTGAGGAAAGTACCAAACAGCAAmplicon SizecDNA: 238 bpgenomic: 11,237
Reverse (334,20)ACTGACAGCCACACCTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.471 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops1.996 kcal/mol in 3' area
Reverse Dimers-1.358 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.905 kcal/mol outside primersite
Amplicon SequenceGTGAGGAAAGTACCAAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCC
TGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTC
ACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCA
AACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)23896 - 333
Exon 1 To Exon 2 (Pair 80)
Forward (143,21)CAGGTCTGAGTGCCTGAACTTAmplicon SizecDNA: 179 bpgenomic: 11,178
Reverse (321,20)CCTTCCCTCCAGCAGTTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.028 kcal/mol
Forward Dimers-1.87 kcal/mol
Reverse Loops1.317 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCAGGTCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCA
CTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTG
GAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)179142 - 320
Exon 1 To Exon 2 (Pair 81)
Forward (202,22)ACTTGGCGTGACTTCACTACTTAmplicon SizecDNA: 122 bpgenomic: 11,121
Reverse (323,20)CACCTTCCCTCCAGCAGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.167 kcal/mol
Forward Dimers-0.53 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACT
GGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGG
TG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)122201 - 322
Exon 1 To Exon 2 (Pair 82)
Forward (184,22)CCTCCAAGGAGTTCAATCACTTAmplicon SizecDNA: 181 bpgenomic: 11,180
Reverse (364,20)CCCAGCAGCAGGATTCGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-1.702 kcal/mol
Reverse Loops1.39 kcal/mol
Reverse Dimers-2.038 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCC
CAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACT
CAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGCTGCTGG
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)181183 - 363
Exon 1 To Exon 2 (Pair 83)
Forward (97,22)GTGAGGAAAGTACCAAACAGCAAmplicon SizecDNA: 227 bpgenomic: 11,226
Reverse (323,20)CACCTTCCCTCCAGCAGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.471 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.905 kcal/mol outside primersite
Amplicon SequenceGTGAGGAAAGTACCAAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCC
TGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTC
ACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCA
AACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)22796 - 322
Exon 1 To Exon 2 (Pair 84)
Forward (198,22)AATCACTTGGCGTGACTTCACTAmplicon SizecDNA: 137 bpgenomic: 11,136
Reverse (334,20)ACTGACAGCCACACCTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol
Forward Dimers-0.595 kcal/mol
Reverse Loops1.996 kcal/mol in 3' area
Reverse Dimers-1.358 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGT
GACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGG
AAGGTGTGGCTGTCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)137197 - 333
Exon 1 To Exon 2 (Pair 85)
Forward (178,22)CTTCATCCTCCAAGGAGTTCAAAmplicon SizecDNA: 187 bpgenomic: 11,186
Reverse (364,20)CCCAGCAGCAGGATTCGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.39 kcal/mol
Reverse Dimers-2.038 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGT
GGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAG
CCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGC
TGCTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)187177 - 363
Exon 1 To Exon 2 (Pair 86)
Forward (97,22)GTGAGGAAAGTACCAAACAGCAAmplicon SizecDNA: 268 bpgenomic: 11,267
Reverse (364,20)CCCAGCAGCAGGATTCGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.471 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops1.39 kcal/mol
Reverse Dimers-2.038 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.905 kcal/mol outside primersite
Amplicon SequenceGTGAGGAAAGTACCAAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCC
TGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTC
ACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCA
AACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTAC
TTTTCATTTTCCGAATCCTGCTGCTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)26896 - 363
Exon 1 To Exon 2 (Pair 87)
Forward (177,22)ACTTCATCCTCCAAGGAGTTCAAmplicon SizecDNA: 158 bpgenomic: 11,157
Reverse (334,20)ACTGACAGCCACACCTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.996 kcal/mol in 3' area
Reverse Dimers-1.358 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAG
TGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAA
GCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)158176 - 333
Exon 1 To Exon 2 (Pair 88)
Forward (102,21)GAAAGTACCAAACAGCAGCGGAmplicon SizecDNA: 226 bpgenomic: 11,225
Reverse (327,19)GCCACACCTTCCCTCCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.471 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.732 kcal/mol in 3' area
Reverse Dimers0.26 kcal/mol in 3' area
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.905 kcal/mol outside primersite
Amplicon SequenceGAAAGTACCAAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCCTGAAC
TTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTAC
TTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTC
CTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)226101 - 326
Exon 1 To Exon 2 (Pair 89)
Forward (147,21)TCTGAGTGCCTGAACTTGCCTAmplicon SizecDNA: 181 bpgenomic: 11,180
Reverse (327,19)GCCACACCTTCCCTCCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.981 kcal/mol
Forward Dimers-1.309 kcal/mol
Reverse Loops2.732 kcal/mol in 3' area
Reverse Dimers0.26 kcal/mol in 3' area
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTG
GCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGC
GCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGG
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)181146 - 326
Exon 1 To Exon 2 (Pair 90)
Forward (196,22)TCAATCACTTGGCGTGACTTCAAmplicon SizecDNA: 132 bpgenomic: 11,131
Reverse (327,19)GCCACACCTTCCCTCCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol
Forward Dimers-0.595 kcal/mol
Reverse Loops2.732 kcal/mol in 3' area
Reverse Dimers0.26 kcal/mol in 3' area
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGG
GTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAG
GGAAGGTGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)132195 - 326
Exon 1 To Exon 2 (Pair 91)
Forward (143,21)CAGGTCTGAGTGCCTGAACTTAmplicon SizecDNA: 185 bpgenomic: 11,184
Reverse (327,19)GCCACACCTTCCCTCCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.028 kcal/mol
Forward Dimers-1.87 kcal/mol
Reverse Loops2.732 kcal/mol in 3' area
Reverse Dimers0.26 kcal/mol in 3' area
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCAGGTCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCA
CTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTG
GAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGT
GTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)185142 - 326
Exon 1 To Exon 2 (Pair 92)
Forward (143,21)CAGGTCTGAGTGCCTGAACTTAmplicon SizecDNA: 222 bpgenomic: 11,221
Reverse (364,20)CCCAGCAGCAGGATTCGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.028 kcal/mol
Forward Dimers-1.87 kcal/mol
Reverse Loops1.39 kcal/mol
Reverse Dimers-2.038 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCAGGTCTGAGTGCCTGAACTTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCA
CTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTG
GAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGT
GTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGCTGCTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)222142 - 363
Exon 1 To Exon 2 (Pair 93)
Forward (182,22)ATCCTCCAAGGAGTTCAATCACAmplicon SizecDNA: 156 bpgenomic: 11,155
Reverse (337,21)AGTACTGACAGCCACACCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-1.778 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTG
CCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTA
CTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)156181 - 336
Exon 1 To Exon 2 (Pair 94)
Forward (196,22)TCAATCACTTGGCGTGACTTCAAmplicon SizecDNA: 144 bpgenomic: 11,143
Reverse (339,22)AAAGTACTGACAGCCACACCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.184 kcal/mol
Forward Dimers-0.595 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-2.86 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGG
GTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAG
GGAAGGTGTGGCTGTCAGTACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)144195 - 338
Exon 1 To Exon 2 (Pair 95)
Forward (102,21)GAAAGTACCAAACAGCAGCGGAmplicon SizecDNA: 220 bpgenomic: 11,219
Reverse (321,20)CCTTCCCTCCAGCAGTTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.471 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.317 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.905 kcal/mol outside primersite
Amplicon SequenceGAAAGTACCAAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCCTGAAC
TTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTAC
TTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTC
CTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)220101 - 320
Exon 1 To Exon 2 (Pair 96)
Forward (184,22)CCTCCAAGGAGTTCAATCACTTAmplicon SizecDNA: 154 bpgenomic: 11,153
Reverse (337,21)AGTACTGACAGCCACACCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.746 kcal/mol
Forward Dimers-1.702 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-1.778 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGGTGCC
CAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACT
CAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)154183 - 336
Exon 1 To Exon 2 (Pair 97)
Forward (178,22)CTTCATCCTCCAAGGAGTTCAAAmplicon SizecDNA: 160 bpgenomic: 11,159
Reverse (337,21)AGTACTGACAGCCACACCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-1.778 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceCTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGT
GGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAG
CCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)160177 - 336
Exon 1 To Exon 2 (Pair 98)
Forward (180,22)TCATCCTCCAAGGAGTTCAATCAmplicon SizecDNA: 142 bpgenomic: 11,141
Reverse (321,20)CCTTCCCTCCAGCAGTTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.317 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGG
TGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCC
TACTCAACTGCTGGAGGGAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)142179 - 320
Exon 1 To Exon 2 (Pair 99)
Forward (102,21)GAAAGTACCAAACAGCAGCGGAmplicon SizecDNA: 238 bpgenomic: 11,237
Reverse (339,22)AAAGTACTGACAGCCACACCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.471 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-2.86 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.905 kcal/mol outside primersite
Amplicon SequenceGAAAGTACCAAACAGCAGCGGAGTTTTAAACTTTAAATAGACAGGTCTGAGTGCCTGAAC
TTGCCTTTTCATTTTACTTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTAC
TTTTAAGCAAAAGAGTGGTGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTC
CTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)238101 - 338
Exon 1 To Exon 2 (Pair 100)
Forward (180,22)TCATCCTCCAAGGAGTTCAATCAmplicon SizecDNA: 158 bpgenomic: 11,157
Reverse (337,21)AGTACTGACAGCCACACCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.402 kcal/mol
Forward Dimers-1.858 kcal/mol
Reverse Loops1.771 kcal/mol
Reverse Dimers-1.778 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.39 kcal/mol outside primersite
Amplicon SequenceTCATCCTCCAAGGAGTTCAATCACTTGGCGTGACTTCACTACTTTTAAGCAAAAGAGTGG
TGCCCAGGCAACATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCC
TACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000165 (GJA1)158179 - 336
 

See below for some more details.

Program Output:

Loading ...