Design Results for gna11

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-2.5 Minimal dG for amplicon folding-2.5
Nr of bases considered as 3'5Minimal Intron Size0

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 4 (Pair 1)
Forward (657,20)CCGGGCATCCAGGAATGCTAAmplicon SizecDNA: 96 bpgenomic: 1,555
Reverse (752,20)CAAGGTGGCGATGCGGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.606 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.722 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-1.111 kcal/mol outside primersite
Amplicon SequenceCCGGGCATCCAGGAATGCTACGACCGCAGGCGCGAGTACCAGCTCTCCGACTCTGCCAAG
TACTACCTGACCGACGTTGACCGCATCGCCACCTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)96657 - 752
Exon 3 To Exon 4 (Pair 2)
Forward (657,20)CCGGGCATCCAGGAATGCTAAmplicon SizecDNA: 95 bpgenomic: 1,554
Reverse (751,20)AAGGTGGCGATGCGGTCAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.606 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.722 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-1.111 kcal/mol outside primersite
Amplicon SequenceCCGGGCATCCAGGAATGCTACGACCGCAGGCGCGAGTACCAGCTCTCCGACTCTGCCAAG
TACTACCTGACCGACGTTGACCGCATCGCCACCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)95657 - 751
Exon 3 To Exon 4 (Pair 3)
Forward (657,20)CCGGGCATCCAGGAATGCTAAmplicon SizecDNA: 93 bpgenomic: 1,552
Reverse (749,19)GGTGGCGATGCGGTCAACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.606 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.891 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-1.111 kcal/mol outside primersite
Amplicon SequenceCCGGGCATCCAGGAATGCTACGACCGCAGGCGCGAGTACCAGCTCTCCGACTCTGCCAAG
TACTACCTGACCGACGTTGACCGCATCGCCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)93657 - 749
Exon 5 To Exon 6 (Pair 1)
Forward (951,20)CAAGTCCTGGTGGAGTCGGAAmplicon SizecDNA: 128 bpgenomic: 280
Reverse (1078,21)AGCAGGTCCTTCTTGTTGAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.73 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops1.587 kcal/mol
Reverse Dimers-2.442 kcal/mol
Forward-Reverse Dimers-1.756 kcal/mol
Amplicon Folding-0.947 kcal/mol outside primersite
Amplicon SequenceCAAGTCCTGGTGGAGTCGGACAACGAGAACCGGATGGAGGAGAGCAAAGCCCTGTTCCGG
ACCATCATCACCTACCCCTGGTTCCAGAACTCCTCCGTCATCCTCTTCCTCAACAAGAAG
GACCTGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)128951 - 1078
Exon 5 To Exon 6 (Pair 2)
Forward (951,20)CAAGTCCTGGTGGAGTCGGAAmplicon SizecDNA: 118 bpgenomic: 270
Reverse (1068,22)TCTTGTTGAGGAAGAGGATGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.73 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers-0.834 kcal/mol
Forward-Reverse Dimers-2.188 kcal/mol
Amplicon Folding-0.947 kcal/mol outside primersite
Amplicon SequenceCAAGTCCTGGTGGAGTCGGACAACGAGAACCGGATGGAGGAGAGCAAAGCCCTGTTCCGG
ACCATCATCACCTACCCCTGGTTCCAGAACTCCTCCGTCATCCTCTTCCTCAACAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)118951 - 1068
Exon 5 To Exon 6 (Pair 3)
Forward (958,20)TGGTGGAGTCGGACAACGAGAmplicon SizecDNA: 123 bpgenomic: 275
Reverse (1080,21)CCAGCAGGTCCTTCTTGTTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol in 3' area
Forward Dimers-1.668 kcal/mol
Reverse Loops0.925 kcal/mol
Reverse Dimers-2.442 kcal/mol
Forward-Reverse Dimers-2.464 kcal/mol
Amplicon Folding-0.947 kcal/mol outside primersite
Amplicon SequenceTGGTGGAGTCGGACAACGAGAACCGGATGGAGGAGAGCAAAGCCCTGTTCCGGACCATCA
TCACCTACCCCTGGTTCCAGAACTCCTCCGTCATCCTCTTCCTCAACAAGAAGGACCTGC
TGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)123958 - 1080
 

See below for some more details.

Program Output:

Loading ...