Design Results for gna11

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size0

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 22)
Forward (529,22)CGCTCAAGATCCTCTACAAGTAAmplicon SizecDNA: 157 bpgenomic: 3,153
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-1.631 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceCGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGG
TGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGT
GGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)157529 - 685
Exon 2 To Exon 3 (Pair 21)
Forward (526,22)AGACGCTCAAGATCCTCTACAAAmplicon SizecDNA: 159 bpgenomic: 3,155
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol in 3' area
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGG
AGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCC
TGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)159526 - 684
Exon 2 To Exon 3 (Pair 20)
Forward (526,22)AGACGCTCAAGATCCTCTACAAAmplicon SizecDNA: 160 bpgenomic: 3,156
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol in 3' area
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGG
AGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCC
TGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)160526 - 685
Exon 2 To Exon 3 (Pair 19)
Forward (542,22)CTACAAGTACGAGCAGAACAAGAmplicon SizecDNA: 144 bpgenomic: 3,140
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.833 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGTGGACGTGGAGAA
GGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTGGGAGGACCCGGG
CATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)144542 - 685
Exon 2 To Exon 3 (Pair 18)
Forward (522,21)ATGGAGACGCTCAAGATCCTCAmplicon SizecDNA: 164 bpgenomic: 3,160
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.358 kcal/mol
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceATGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATC
CGGGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAG
ACCCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)164522 - 685
Exon 2 To Exon 3 (Pair 17)
Forward (523,21)TGGAGACGCTCAAGATCCTCTAmplicon SizecDNA: 162 bpgenomic: 3,158
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceTGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCC
GGGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGA
CCCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)162523 - 684
Exon 2 To Exon 3 (Pair 16)
Forward (525,21)GAGACGCTCAAGATCCTCTACAmplicon SizecDNA: 161 bpgenomic: 3,157
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol in 3' area
Forward Dimers-0.57 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGG
GAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACC
CTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)161525 - 685
Exon 2 To Exon 3 (Pair 15)
Forward (528,22)ACGCTCAAGATCCTCTACAAGTAmplicon SizecDNA: 158 bpgenomic: 3,154
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAG
GTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTG
TGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)158528 - 685
Exon 2 To Exon 3 (Pair 14)
Forward (542,22)CTACAAGTACGAGCAGAACAAGAmplicon SizecDNA: 143 bpgenomic: 3,139
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.189 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGTGGACGTGGAGAA
GGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTGGGAGGACCCGGG
CATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)143542 - 684
Exon 2 To Exon 3 (Pair 13)
Forward (521,21)CATGGAGACGCTCAAGATCCTAmplicon SizecDNA: 164 bpgenomic: 3,160
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.358 kcal/mol
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceCATGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGAT
CCGGGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAA
GACCCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)164521 - 684
Exon 2 To Exon 3 (Pair 12)
Forward (522,21)ATGGAGACGCTCAAGATCCTCAmplicon SizecDNA: 163 bpgenomic: 3,159
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.358 kcal/mol
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceATGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATC
CGGGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAG
ACCCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)163522 - 684
Exon 2 To Exon 3 (Pair 11)
Forward (524,21)GGAGACGCTCAAGATCCTCTAAmplicon SizecDNA: 162 bpgenomic: 3,158
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol in 3' area
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCG
GGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGAC
CCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)162524 - 685
Exon 2 To Exon 3 (Pair 10)
Forward (523,21)TGGAGACGCTCAAGATCCTCTAmplicon SizecDNA: 163 bpgenomic: 3,159
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceTGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCC
GGGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGA
CCCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)163523 - 685
Exon 2 To Exon 3 (Pair 9)
Forward (524,21)GGAGACGCTCAAGATCCTCTAAmplicon SizecDNA: 161 bpgenomic: 3,157
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol in 3' area
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCG
GGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGAC
CCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)161524 - 684
Exon 2 To Exon 3 (Pair 8)
Forward (521,21)CATGGAGACGCTCAAGATCCTAmplicon SizecDNA: 165 bpgenomic: 3,161
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.358 kcal/mol
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceCATGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGAT
CCGGGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAA
GACCCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)165521 - 685
Exon 2 To Exon 3 (Pair 7)
Forward (540,22)CTCTACAAGTACGAGCAGAACAAmplicon SizecDNA: 145 bpgenomic: 3,141
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.189 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGTGGACGTGGAG
AAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTGGGAGGACCCG
GGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)145540 - 684
Exon 2 To Exon 3 (Pair 6)
Forward (525,21)GAGACGCTCAAGATCCTCTACAmplicon SizecDNA: 160 bpgenomic: 3,156
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol in 3' area
Forward Dimers-0.57 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGG
GAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACC
CTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)160525 - 684
Exon 2 To Exon 3 (Pair 5)
Forward (528,22)ACGCTCAAGATCCTCTACAAGTAmplicon SizecDNA: 157 bpgenomic: 3,153
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAG
GTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTG
TGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)157528 - 684
Exon 2 To Exon 3 (Pair 4)
Forward (538,22)TCCTCTACAAGTACGAGCAGAAAmplicon SizecDNA: 147 bpgenomic: 3,143
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.208 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.189 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceTCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGTGGACGTGG
AGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTGGGAGGACC
CGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)147538 - 684
Exon 2 To Exon 3 (Pair 3)
Forward (537,22)ATCCTCTACAAGTACGAGCAGAAmplicon SizecDNA: 148 bpgenomic: 3,144
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.208 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.189 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGTGGACGTG
GAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTGGGAGGAC
CCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)148537 - 684
Exon 2 To Exon 3 (Pair 2)
Forward (530,22)GCTCAAGATCCTCTACAAGTACAmplicon SizecDNA: 155 bpgenomic: 3,151
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGT
GGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTG
GGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)155530 - 684
Exon 2 To Exon 3 (Pair 1)
Forward (529,22)CGCTCAAGATCCTCTACAAGTAAmplicon SizecDNA: 156 bpgenomic: 3,152
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-1.631 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceCGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGG
TGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGT
GGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)156529 - 684
Exon 2 To Exon 3 (Pair 23)
Forward (530,22)GCTCAAGATCCTCTACAAGTACAmplicon SizecDNA: 156 bpgenomic: 3,152
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGT
GGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTG
GGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)156530 - 685
Exon 3 To Exon 4 (Pair 3)
Forward (657,20)CCGGGCATCCAGGAATGCTAAmplicon SizecDNA: 95 bpgenomic: 1,554
Reverse (751,20)AAGGTGGCGATGCGGTCAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.606 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.722 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-1.111 kcal/mol outside primersite
Amplicon SequenceCCGGGCATCCAGGAATGCTACGACCGCAGGCGCGAGTACCAGCTCTCCGACTCTGCCAAG
TACTACCTGACCGACGTTGACCGCATCGCCACCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)95657 - 751
Exon 3 To Exon 4 (Pair 2)
Forward (657,20)CCGGGCATCCAGGAATGCTAAmplicon SizecDNA: 96 bpgenomic: 1,555
Reverse (752,20)CAAGGTGGCGATGCGGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.606 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.722 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-1.111 kcal/mol outside primersite
Amplicon SequenceCCGGGCATCCAGGAATGCTACGACCGCAGGCGCGAGTACCAGCTCTCCGACTCTGCCAAG
TACTACCTGACCGACGTTGACCGCATCGCCACCTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)96657 - 752
Exon 3 To Exon 4 (Pair 1)
Forward (657,20)CCGGGCATCCAGGAATGCTAAmplicon SizecDNA: 93 bpgenomic: 1,552
Reverse (749,19)GGTGGCGATGCGGTCAACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.606 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.891 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-1.111 kcal/mol outside primersite
Amplicon SequenceCCGGGCATCCAGGAATGCTACGACCGCAGGCGCGAGTACCAGCTCTCCGACTCTGCCAAG
TACTACCTGACCGACGTTGACCGCATCGCCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)93657 - 749
Exon 5 To Exon 6 (Pair 3)
Forward (951,20)CAAGTCCTGGTGGAGTCGGAAmplicon SizecDNA: 129 bpgenomic: 281
Reverse (1079,21)CAGCAGGTCCTTCTTGTTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.73 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops1.556 kcal/mol in 3' area
Reverse Dimers-2.442 kcal/mol
Forward-Reverse Dimers-2.793 kcal/mol
Amplicon Folding-0.947 kcal/mol outside primersite
Amplicon SequenceCAAGTCCTGGTGGAGTCGGACAACGAGAACCGGATGGAGGAGAGCAAAGCCCTGTTCCGG
ACCATCATCACCTACCCCTGGTTCCAGAACTCCTCCGTCATCCTCTTCCTCAACAAGAAG
GACCTGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)129951 - 1079
Exon 5 To Exon 6 (Pair 2)
Forward (951,20)CAAGTCCTGGTGGAGTCGGAAmplicon SizecDNA: 128 bpgenomic: 280
Reverse (1078,21)AGCAGGTCCTTCTTGTTGAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.73 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops1.587 kcal/mol
Reverse Dimers-2.442 kcal/mol
Forward-Reverse Dimers-1.756 kcal/mol
Amplicon Folding-0.947 kcal/mol outside primersite
Amplicon SequenceCAAGTCCTGGTGGAGTCGGACAACGAGAACCGGATGGAGGAGAGCAAAGCCCTGTTCCGG
ACCATCATCACCTACCCCTGGTTCCAGAACTCCTCCGTCATCCTCTTCCTCAACAAGAAG
GACCTGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)128951 - 1078
Exon 5 To Exon 6 (Pair 1)
Forward (951,20)CAAGTCCTGGTGGAGTCGGAAmplicon SizecDNA: 118 bpgenomic: 270
Reverse (1068,22)TCTTGTTGAGGAAGAGGATGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.73 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers-0.834 kcal/mol
Forward-Reverse Dimers-2.188 kcal/mol
Amplicon Folding-0.947 kcal/mol outside primersite
Amplicon SequenceCAAGTCCTGGTGGAGTCGGACAACGAGAACCGGATGGAGGAGAGCAAAGCCCTGTTCCGG
ACCATCATCACCTACCCCTGGTTCCAGAACTCCTCCGTCATCCTCTTCCTCAACAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)118951 - 1068
Exon 5 To Exon 6 (Pair 4)
Forward (958,20)TGGTGGAGTCGGACAACGAGAmplicon SizecDNA: 123 bpgenomic: 275
Reverse (1080,21)CCAGCAGGTCCTTCTTGTTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol in 3' area
Forward Dimers-1.668 kcal/mol
Reverse Loops0.925 kcal/mol
Reverse Dimers-2.442 kcal/mol
Forward-Reverse Dimers-2.464 kcal/mol
Amplicon Folding-0.947 kcal/mol outside primersite
Amplicon SequenceTGGTGGAGTCGGACAACGAGAACCGGATGGAGGAGAGCAAAGCCCTGTTCCGGACCATCA
TCACCTACCCCTGGTTCCAGAACTCCTCCGTCATCCTCTTCCTCAACAAGAAGGACCTGC
TGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)123958 - 1080
Exon 6 To Exon 7 (Pair 12)
Forward (1085,21)CAAGATCCTGTACTCGCACCTAmplicon SizecDNA: 134 bpgenomic: 1,763
Reverse (1218,22)AGTAGATGATCTTGTCGCTGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.869 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.308 kcal/mol
Reverse Dimers-2.056 kcal/mol
Forward-Reverse Dimers-2.382 kcal/mol
Amplicon Folding-2.65 kcal/mol outside primersite
Amplicon SequenceCAAGATCCTGTACTCGCACCTGGTGGACTACTTCCCCGAGTTCGATGGTCCCCAGCGGGA
CGCCCAGGCGGCGCGGGAGTTCATCCTGAAGATGTTCGTGGACCTGAACCCCGACAGCGA
CAAGATCATCTACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)1341085 - 1218
Exon 6 To Exon 7 (Pair 11)
Forward (1084,21)ACAAGATCCTGTACTCGCACCAmplicon SizecDNA: 111 bpgenomic: 1,740
Reverse (1194,21)GGTTCAGGTCCACGAACATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.725 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.124 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.553 kcal/mol
Amplicon Folding-2.65 kcal/mol outside primersite
Amplicon SequenceACAAGATCCTGTACTCGCACCTGGTGGACTACTTCCCCGAGTTCGATGGTCCCCAGCGGG
ACGCCCAGGCGGCGCGGGAGTTCATCCTGAAGATGTTCGTGGACCTGAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)1111084 - 1194
Exon 6 To Exon 7 (Pair 10)
Forward (1085,21)CAAGATCCTGTACTCGCACCTAmplicon SizecDNA: 131 bpgenomic: 1,760
Reverse (1215,21)AGATGATCTTGTCGCTGTCGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.869 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.284 kcal/mol in 3' area
Reverse Dimers-1.596 kcal/mol
Forward-Reverse Dimers-2.382 kcal/mol
Amplicon Folding-2.65 kcal/mol outside primersite
Amplicon SequenceCAAGATCCTGTACTCGCACCTGGTGGACTACTTCCCCGAGTTCGATGGTCCCCAGCGGGA
CGCCCAGGCGGCGCGGGAGTTCATCCTGAAGATGTTCGTGGACCTGAACCCCGACAGCGA
CAAGATCATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)1311085 - 1215
Exon 6 To Exon 7 (Pair 9)
Forward (1085,21)CAAGATCCTGTACTCGCACCTAmplicon SizecDNA: 135 bpgenomic: 1,764
Reverse (1219,22)GAGTAGATGATCTTGTCGCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.869 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.308 kcal/mol
Reverse Dimers-2.056 kcal/mol
Forward-Reverse Dimers-2.382 kcal/mol
Amplicon Folding-2.65 kcal/mol outside primersite
Amplicon SequenceCAAGATCCTGTACTCGCACCTGGTGGACTACTTCCCCGAGTTCGATGGTCCCCAGCGGGA
CGCCCAGGCGGCGCGGGAGTTCATCCTGAAGATGTTCGTGGACCTGAACCCCGACAGCGA
CAAGATCATCTACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)1351085 - 1219
Exon 6 To Exon 7 (Pair 8)
Forward (1082,21)GGACAAGATCCTGTACTCGCAAmplicon SizecDNA: 113 bpgenomic: 1,742
Reverse (1194,21)GGTTCAGGTCCACGAACATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.828 kcal/mol
Forward Dimers-1.736 kcal/mol
Reverse Loops1.124 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.01 kcal/mol
Amplicon Folding-2.65 kcal/mol outside primersite
Amplicon SequenceGGACAAGATCCTGTACTCGCACCTGGTGGACTACTTCCCCGAGTTCGATGGTCCCCAGCG
GGACGCCCAGGCGGCGCGGGAGTTCATCCTGAAGATGTTCGTGGACCTGAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)1131082 - 1194
Exon 6 To Exon 7 (Pair 7)
Forward (1085,21)CAAGATCCTGTACTCGCACCTAmplicon SizecDNA: 104 bpgenomic: 1,733
Reverse (1188,21)GGTCCACGAACATCTTCAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.869 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.618 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.65 kcal/mol outside primersite
Amplicon SequenceCAAGATCCTGTACTCGCACCTGGTGGACTACTTCCCCGAGTTCGATGGTCCCCAGCGGGA
CGCCCAGGCGGCGCGGGAGTTCATCCTGAAGATGTTCGTGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)1041085 - 1188
Exon 6 To Exon 7 (Pair 6)
Forward (1084,21)ACAAGATCCTGTACTCGCACCAmplicon SizecDNA: 105 bpgenomic: 1,734
Reverse (1188,21)GGTCCACGAACATCTTCAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.725 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.618 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.65 kcal/mol outside primersite
Amplicon SequenceACAAGATCCTGTACTCGCACCTGGTGGACTACTTCCCCGAGTTCGATGGTCCCCAGCGGG
ACGCCCAGGCGGCGCGGGAGTTCATCCTGAAGATGTTCGTGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)1051084 - 1188
Exon 6 To Exon 7 (Pair 5)
Forward (1083,21)GACAAGATCCTGTACTCGCACAmplicon SizecDNA: 106 bpgenomic: 1,735
Reverse (1188,21)GGTCCACGAACATCTTCAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.162 kcal/mol
Forward Dimers-1.736 kcal/mol
Reverse Loops1.618 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.65 kcal/mol outside primersite
Amplicon SequenceGACAAGATCCTGTACTCGCACCTGGTGGACTACTTCCCCGAGTTCGATGGTCCCCAGCGG
GACGCCCAGGCGGCGCGGGAGTTCATCCTGAAGATGTTCGTGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)1061083 - 1188
Exon 6 To Exon 7 (Pair 4)
Forward (1085,21)CAAGATCCTGTACTCGCACCTAmplicon SizecDNA: 136 bpgenomic: 1,765
Reverse (1220,22)TGAGTAGATGATCTTGTCGCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.869 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.308 kcal/mol
Reverse Dimers-2.056 kcal/mol
Forward-Reverse Dimers-2.382 kcal/mol
Amplicon Folding-2.65 kcal/mol outside primersite
Amplicon SequenceCAAGATCCTGTACTCGCACCTGGTGGACTACTTCCCCGAGTTCGATGGTCCCCAGCGGGA
CGCCCAGGCGGCGCGGGAGTTCATCCTGAAGATGTTCGTGGACCTGAACCCCGACAGCGA
CAAGATCATCTACTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)1361085 - 1220
Exon 6 To Exon 7 (Pair 3)
Forward (1083,21)GACAAGATCCTGTACTCGCACAmplicon SizecDNA: 112 bpgenomic: 1,741
Reverse (1194,21)GGTTCAGGTCCACGAACATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.162 kcal/mol
Forward Dimers-1.736 kcal/mol
Reverse Loops1.124 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.553 kcal/mol
Amplicon Folding-2.65 kcal/mol outside primersite
Amplicon SequenceGACAAGATCCTGTACTCGCACCTGGTGGACTACTTCCCCGAGTTCGATGGTCCCCAGCGG
GACGCCCAGGCGGCGCGGGAGTTCATCCTGAAGATGTTCGTGGACCTGAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)1121083 - 1194
Exon 6 To Exon 7 (Pair 2)
Forward (1082,21)GGACAAGATCCTGTACTCGCAAmplicon SizecDNA: 107 bpgenomic: 1,736
Reverse (1188,21)GGTCCACGAACATCTTCAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.828 kcal/mol
Forward Dimers-1.736 kcal/mol
Reverse Loops1.618 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.65 kcal/mol outside primersite
Amplicon SequenceGGACAAGATCCTGTACTCGCACCTGGTGGACTACTTCCCCGAGTTCGATGGTCCCCAGCG
GGACGCCCAGGCGGCGCGGGAGTTCATCCTGAAGATGTTCGTGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)1071082 - 1188
Exon 6 To Exon 7 (Pair 1)
Forward (1085,21)CAAGATCCTGTACTCGCACCTAmplicon SizecDNA: 137 bpgenomic: 1,766
Reverse (1221,22)GTGAGTAGATGATCTTGTCGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.869 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.308 kcal/mol
Reverse Dimers-2.056 kcal/mol
Forward-Reverse Dimers-2.382 kcal/mol
Amplicon Folding-2.65 kcal/mol outside primersite
Amplicon SequenceCAAGATCCTGTACTCGCACCTGGTGGACTACTTCCCCGAGTTCGATGGTCCCCAGCGGGA
CGCCCAGGCGGCGCGGGAGTTCATCCTGAAGATGTTCGTGGACCTGAACCCCGACAGCGA
CAAGATCATCTACTCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)1371085 - 1221
 

See below for some more details.

Program Output:

Loading ...