Design Results for gna11

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size2000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (529,22)CGCTCAAGATCCTCTACAAGTAAmplicon SizecDNA: 156 bpgenomic: 3,152
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-1.631 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceCGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGG
TGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGT
GGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)156529 - 684
Exon 2 To Exon 3 (Pair 2)
Forward (530,22)GCTCAAGATCCTCTACAAGTACAmplicon SizecDNA: 155 bpgenomic: 3,151
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGT
GGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTG
GGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)155530 - 684
Exon 2 To Exon 3 (Pair 3)
Forward (537,22)ATCCTCTACAAGTACGAGCAGAAmplicon SizecDNA: 148 bpgenomic: 3,144
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.208 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.189 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGTGGACGTG
GAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTGGGAGGAC
CCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)148537 - 684
Exon 2 To Exon 3 (Pair 4)
Forward (538,22)TCCTCTACAAGTACGAGCAGAAAmplicon SizecDNA: 147 bpgenomic: 3,143
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.208 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.189 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceTCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGTGGACGTGG
AGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTGGGAGGACC
CGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)147538 - 684
Exon 2 To Exon 3 (Pair 5)
Forward (528,22)ACGCTCAAGATCCTCTACAAGTAmplicon SizecDNA: 157 bpgenomic: 3,153
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAG
GTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTG
TGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)157528 - 684
Exon 2 To Exon 3 (Pair 6)
Forward (525,21)GAGACGCTCAAGATCCTCTACAmplicon SizecDNA: 160 bpgenomic: 3,156
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol in 3' area
Forward Dimers-0.57 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGG
GAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACC
CTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)160525 - 684
Exon 2 To Exon 3 (Pair 7)
Forward (540,22)CTCTACAAGTACGAGCAGAACAAmplicon SizecDNA: 145 bpgenomic: 3,141
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.189 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGTGGACGTGGAG
AAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTGGGAGGACCCG
GGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)145540 - 684
Exon 2 To Exon 3 (Pair 8)
Forward (521,21)CATGGAGACGCTCAAGATCCTAmplicon SizecDNA: 165 bpgenomic: 3,161
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.358 kcal/mol
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceCATGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGAT
CCGGGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAA
GACCCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)165521 - 685
Exon 2 To Exon 3 (Pair 9)
Forward (524,21)GGAGACGCTCAAGATCCTCTAAmplicon SizecDNA: 161 bpgenomic: 3,157
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol in 3' area
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCG
GGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGAC
CCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)161524 - 684
Exon 2 To Exon 3 (Pair 10)
Forward (523,21)TGGAGACGCTCAAGATCCTCTAmplicon SizecDNA: 163 bpgenomic: 3,159
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceTGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCC
GGGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGA
CCCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)163523 - 685
Exon 2 To Exon 3 (Pair 11)
Forward (524,21)GGAGACGCTCAAGATCCTCTAAmplicon SizecDNA: 162 bpgenomic: 3,158
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol in 3' area
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCG
GGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGAC
CCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)162524 - 685
Exon 2 To Exon 3 (Pair 12)
Forward (522,21)ATGGAGACGCTCAAGATCCTCAmplicon SizecDNA: 163 bpgenomic: 3,159
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.358 kcal/mol
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceATGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATC
CGGGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAG
ACCCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)163522 - 684
Exon 2 To Exon 3 (Pair 13)
Forward (521,21)CATGGAGACGCTCAAGATCCTAmplicon SizecDNA: 164 bpgenomic: 3,160
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.358 kcal/mol
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceCATGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGAT
CCGGGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAA
GACCCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)164521 - 684
Exon 2 To Exon 3 (Pair 14)
Forward (542,22)CTACAAGTACGAGCAGAACAAGAmplicon SizecDNA: 143 bpgenomic: 3,139
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.189 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGTGGACGTGGAGAA
GGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTGGGAGGACCCGGG
CATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)143542 - 684
Exon 2 To Exon 3 (Pair 15)
Forward (528,22)ACGCTCAAGATCCTCTACAAGTAmplicon SizecDNA: 158 bpgenomic: 3,154
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAG
GTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTG
TGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)158528 - 685
Exon 2 To Exon 3 (Pair 16)
Forward (525,21)GAGACGCTCAAGATCCTCTACAmplicon SizecDNA: 161 bpgenomic: 3,157
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol in 3' area
Forward Dimers-0.57 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGG
GAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACC
CTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)161525 - 685
Exon 2 To Exon 3 (Pair 17)
Forward (523,21)TGGAGACGCTCAAGATCCTCTAmplicon SizecDNA: 162 bpgenomic: 3,158
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceTGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCC
GGGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGA
CCCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)162523 - 684
Exon 2 To Exon 3 (Pair 18)
Forward (542,22)CTACAAGTACGAGCAGAACAAGAmplicon SizecDNA: 144 bpgenomic: 3,140
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.833 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGTGGACGTGGAGAA
GGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTGGGAGGACCCGGG
CATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)144542 - 685
Exon 2 To Exon 3 (Pair 19)
Forward (522,21)ATGGAGACGCTCAAGATCCTCAmplicon SizecDNA: 164 bpgenomic: 3,160
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.358 kcal/mol
Forward Dimers-0.847 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceATGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATC
CGGGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAG
ACCCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)164522 - 685
Exon 2 To Exon 3 (Pair 20)
Forward (526,22)AGACGCTCAAGATCCTCTACAAAmplicon SizecDNA: 160 bpgenomic: 3,156
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol in 3' area
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGG
AGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCC
TGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)160526 - 685
Exon 2 To Exon 3 (Pair 21)
Forward (526,22)AGACGCTCAAGATCCTCTACAAAmplicon SizecDNA: 159 bpgenomic: 3,155
Reverse (684,20)TGCGGTCGTAGCATTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol in 3' area
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-0.974 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGG
AGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCC
TGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)159526 - 684
Exon 2 To Exon 3 (Pair 22)
Forward (529,22)CGCTCAAGATCCTCTACAAGTAAmplicon SizecDNA: 157 bpgenomic: 3,153
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-1.631 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceCGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGG
TGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGT
GGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)157529 - 685
Exon 2 To Exon 3 (Pair 23)
Forward (530,22)GCTCAAGATCCTCTACAAGTACAmplicon SizecDNA: 156 bpgenomic: 3,152
Reverse (685,20)CTGCGGTCGTAGCATTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.06 kcal/mol
Forward Dimers-0.548 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-1.148 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-2.526 kcal/mol outside primersite
Amplicon SequenceGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGT
GGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTG
GGAGGACCCGGGCATCCAGGAATGCTACGACCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002067 (GNA11)156530 - 685
 

See below for some more details.

Program Output:

Loading ...