Design Results for gnaq

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-1 Minimal dG for amplicon folding-1
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 4 To Exon 6 (Pair 1)
Forward (571,19)CTGACCCTGCCTACCTGCCAmplicon SizecDNA: 257 bpgenomic: 68,979
Reverse (827,21)AGCCTTGCTTTCCTCCATTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.756 kcal/mol
Reverse Dimers-0.843 kcal/mol
Forward-Reverse Dimers-0.38 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAG
GGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGG
GCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGT
TTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAA
TGGAGGAAAGCAAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)257717 - 973
Exon 4 To Exon 6 (Pair 2)
Forward (570,19)GCTGACCCTGCCTACCTGCAmplicon SizecDNA: 258 bpgenomic: 68,980
Reverse (827,21)AGCCTTGCTTTCCTCCATTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.817 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.756 kcal/mol
Reverse Dimers-0.843 kcal/mol
Forward-Reverse Dimers-0.924 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACA
GGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGG
GGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATG
TTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGA
ATGGAGGAAAGCAAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)258716 - 973
Exon 4 To Exon 6 (Pair 3)
Forward (572,20)TGACCCTGCCTACCTGCCTAAmplicon SizecDNA: 256 bpgenomic: 68,978
Reverse (827,21)AGCCTTGCTTTCCTCCATTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.756 kcal/mol
Reverse Dimers-0.843 kcal/mol
Forward-Reverse Dimers-0.38 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGG
GATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGG
CCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTT
TCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAAT
GGAGGAAAGCAAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)256718 - 973
 

See below for some more details.

Program Output:

Loading ...