Design Results for gnaq

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-2 Minimal dG for amplicon folding-2
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 4 (Pair 1)
Forward (395,23)TGCACAATTAGTTCGAGAAGTTGAmplicon SizecDNA: 197 bpgenomic: 18,164
Reverse (591,20)TAGGCAGGTAGGCAGGGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.204 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.251 kcal/mol
Amplicon Folding-1.858 kcal/mol outside primersite
Amplicon SequenceTGCACAATTAGTTCGAGAAGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATATGT
AGATGCAATAAAGAGTTTATGGAATGATCCTGGAATCCAGGAATGCTATGATAGACGACG
AGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTTGGACCGCGTAGCTGA
CCCTGCCTACCTGCCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)197541 - 737
Exon 3 To Exon 4 (Pair 2)
Forward (393,23)CATGCACAATTAGTTCGAGAAGTAmplicon SizecDNA: 199 bpgenomic: 18,166
Reverse (591,20)TAGGCAGGTAGGCAGGGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-1.726 kcal/mol
Reverse Loops1.204 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.552 kcal/mol
Amplicon Folding-1.858 kcal/mol outside primersite
Amplicon SequenceCATGCACAATTAGTTCGAGAAGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATAT
GTAGATGCAATAAAGAGTTTATGGAATGATCCTGGAATCCAGGAATGCTATGATAGACGA
CGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTTGGACCGCGTAGCT
GACCCTGCCTACCTGCCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)199539 - 737
Exon 3 To Exon 4 (Pair 3)
Forward (488,23)AATCCAGGAATGCTATGATAGACAmplicon SizecDNA: 104 bpgenomic: 18,071
Reverse (591,20)TAGGCAGGTAGGCAGGGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.91 kcal/mol
Forward Dimers-1.444 kcal/mol
Reverse Loops1.204 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.298 kcal/mol
Amplicon Folding-0.075 kcal/mol outside primersite
Amplicon SequenceAATCCAGGAATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTA
TCTTAATGACTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)104634 - 737
Exon 3 To Exon 4 (Pair 4)
Forward (392,23)TCATGCACAATTAGTTCGAGAAGAmplicon SizecDNA: 200 bpgenomic: 18,167
Reverse (591,20)TAGGCAGGTAGGCAGGGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-1.726 kcal/mol
Reverse Loops1.204 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.552 kcal/mol
Amplicon Folding-1.858 kcal/mol outside primersite
Amplicon SequenceTCATGCACAATTAGTTCGAGAAGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATA
TGTAGATGCAATAAAGAGTTTATGGAATGATCCTGGAATCCAGGAATGCTATGATAGACG
ACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTTGGACCGCGTAGC
TGACCCTGCCTACCTGCCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)200538 - 737
Exon 4 To Exon 6 (Pair 1)
Forward (646,24)CCTTTGACTTACAAAGTGTCATTTAmplicon SizecDNA: 180 bpgenomic: 68,902
Reverse (825,21)CCTTGCTTTCCTCCATTCGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops1.376 kcal/mol in 3' area
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGA
GAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTA
GTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)180792 - 971
Exon 4 To Exon 6 (Pair 2)
Forward (572,20)TGACCCTGCCTACCTGCCTAAmplicon SizecDNA: 257 bpgenomic: 68,979
Reverse (828,21)GAGCCTTGCTTTCCTCCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-0.38 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGG
GATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGG
CCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTT
TCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAAT
GGAGGAAAGCAAGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)257718 - 974
Exon 4 To Exon 6 (Pair 3)
Forward (646,24)CCTTTGACTTACAAAGTGTCATTTAmplicon SizecDNA: 183 bpgenomic: 68,905
Reverse (828,21)GAGCCTTGCTTTCCTCCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGA
GAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTA
GTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGG
CTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)183792 - 974
Exon 4 To Exon 6 (Pair 4)
Forward (592,22)CGCAACAAGATGTGCTTAGAGTAmplicon SizecDNA: 239 bpgenomic: 68,961
Reverse (830,21)GAGAGCCTTGCTTTCCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.714 kcal/mol
Forward Dimers-0.859 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.865 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTG
ACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAA
AATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAAT
ATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)239738 - 976
Exon 4 To Exon 6 (Pair 5)
Forward (570,19)GCTGACCCTGCCTACCTGCAmplicon SizecDNA: 262 bpgenomic: 68,984
Reverse (831,21)AGAGAGCCTTGCTTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.817 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.487 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACA
GGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGG
GGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATG
TTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGA
ATGGAGGAAAGCAAGGCTCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)262716 - 977
Exon 4 To Exon 6 (Pair 6)
Forward (646,24)CCTTTGACTTACAAAGTGTCATTTAmplicon SizecDNA: 185 bpgenomic: 68,907
Reverse (830,21)GAGAGCCTTGCTTTCCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGA
GAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTA
GTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGG
CTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)185792 - 976
Exon 4 To Exon 6 (Pair 7)
Forward (571,19)CTGACCCTGCCTACCTGCCAmplicon SizecDNA: 257 bpgenomic: 68,979
Reverse (827,21)AGCCTTGCTTTCCTCCATTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.756 kcal/mol
Reverse Dimers-0.843 kcal/mol
Forward-Reverse Dimers-0.38 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAG
GGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGG
GCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGT
TTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAA
TGGAGGAAAGCAAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)257717 - 973
Exon 4 To Exon 6 (Pair 8)
Forward (571,19)CTGACCCTGCCTACCTGCCAmplicon SizecDNA: 258 bpgenomic: 68,980
Reverse (828,21)GAGCCTTGCTTTCCTCCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-0.38 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAG
GGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGG
GCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGT
TTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAA
TGGAGGAAAGCAAGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)258717 - 974
Exon 4 To Exon 6 (Pair 9)
Forward (645,23)CCCTTTGACTTACAAAGTGTCATAmplicon SizecDNA: 184 bpgenomic: 68,906
Reverse (828,21)GAGCCTTGCTTTCCTCCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAG
AGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTT
AGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAG
GCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)184791 - 974
Exon 4 To Exon 6 (Pair 10)
Forward (571,19)CTGACCCTGCCTACCTGCCAmplicon SizecDNA: 260 bpgenomic: 68,982
Reverse (830,21)GAGAGCCTTGCTTTCCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-0.799 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAG
GGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGG
GCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGT
TTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAA
TGGAGGAAAGCAAGGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)260717 - 976
Exon 4 To Exon 6 (Pair 11)
Forward (571,19)CTGACCCTGCCTACCTGCCAmplicon SizecDNA: 261 bpgenomic: 68,983
Reverse (831,21)AGAGAGCCTTGCTTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-0.799 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAG
GGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGG
GCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGT
TTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAA
TGGAGGAAAGCAAGGCTCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)261717 - 977
Exon 4 To Exon 6 (Pair 12)
Forward (645,23)CCCTTTGACTTACAAAGTGTCATAmplicon SizecDNA: 183 bpgenomic: 68,905
Reverse (827,21)AGCCTTGCTTTCCTCCATTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.756 kcal/mol
Reverse Dimers-0.843 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAG
AGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTT
AGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAG
GCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)183791 - 973
Exon 4 To Exon 6 (Pair 13)
Forward (570,19)GCTGACCCTGCCTACCTGCAmplicon SizecDNA: 263 bpgenomic: 68,985
Reverse (832,21)AAGAGAGCCTTGCTTTCCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.817 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.487 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACA
GGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGG
GGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATG
TTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGA
ATGGAGGAAAGCAAGGCTCTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)263716 - 978
Exon 4 To Exon 6 (Pair 14)
Forward (572,20)TGACCCTGCCTACCTGCCTAAmplicon SizecDNA: 256 bpgenomic: 68,978
Reverse (827,21)AGCCTTGCTTTCCTCCATTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.756 kcal/mol
Reverse Dimers-0.843 kcal/mol
Forward-Reverse Dimers-0.38 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGG
GATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGG
CCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTT
TCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAAT
GGAGGAAAGCAAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)256718 - 973
Exon 4 To Exon 6 (Pair 15)
Forward (646,24)CCTTTGACTTACAAAGTGTCATTTAmplicon SizecDNA: 187 bpgenomic: 68,909
Reverse (832,21)AAGAGAGCCTTGCTTTCCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGA
GAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTA
GTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGG
CTCTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)187792 - 978
Exon 4 To Exon 6 (Pair 16)
Forward (592,22)CGCAACAAGATGTGCTTAGAGTAmplicon SizecDNA: 240 bpgenomic: 68,962
Reverse (831,21)AGAGAGCCTTGCTTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.714 kcal/mol
Forward Dimers-0.859 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.865 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTG
ACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAA
AATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAAT
ATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCTCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)240738 - 977
Exon 4 To Exon 6 (Pair 17)
Forward (646,24)CCTTTGACTTACAAAGTGTCATTTAmplicon SizecDNA: 182 bpgenomic: 68,904
Reverse (827,21)AGCCTTGCTTTCCTCCATTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.756 kcal/mol
Reverse Dimers-0.843 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGA
GAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTA
GTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGG
CT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)182792 - 973
Exon 4 To Exon 6 (Pair 18)
Forward (645,23)CCCTTTGACTTACAAAGTGTCATAmplicon SizecDNA: 187 bpgenomic: 68,909
Reverse (831,21)AGAGAGCCTTGCTTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAG
AGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTT
AGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAG
GCTCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)187791 - 977
Exon 4 To Exon 6 (Pair 19)
Forward (592,22)CGCAACAAGATGTGCTTAGAGTAmplicon SizecDNA: 241 bpgenomic: 68,963
Reverse (832,21)AAGAGAGCCTTGCTTTCCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.714 kcal/mol
Forward Dimers-0.859 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.865 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTG
ACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAA
AATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAAT
ATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCTCTCT
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)241738 - 978
Exon 4 To Exon 6 (Pair 20)
Forward (592,22)CGCAACAAGATGTGCTTAGAGTAmplicon SizecDNA: 236 bpgenomic: 68,958
Reverse (827,21)AGCCTTGCTTTCCTCCATTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.714 kcal/mol
Forward Dimers-0.859 kcal/mol
Reverse Loops0.756 kcal/mol
Reverse Dimers-0.843 kcal/mol
Forward-Reverse Dimers-1.767 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTG
ACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAA
AATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAAT
ATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)236738 - 973
Exon 4 To Exon 6 (Pair 21)
Forward (570,19)GCTGACCCTGCCTACCTGCAmplicon SizecDNA: 259 bpgenomic: 68,981
Reverse (828,21)GAGCCTTGCTTTCCTCCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.817 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.487 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACA
GGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGG
GGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATG
TTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGA
ATGGAGGAAAGCAAGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)259716 - 974
Exon 4 To Exon 6 (Pair 22)
Forward (570,19)GCTGACCCTGCCTACCTGCAmplicon SizecDNA: 261 bpgenomic: 68,983
Reverse (830,21)GAGAGCCTTGCTTTCCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.817 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.487 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACA
GGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGG
GGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATG
TTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGA
ATGGAGGAAAGCAAGGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)261716 - 976
Exon 4 To Exon 6 (Pair 23)
Forward (572,20)TGACCCTGCCTACCTGCCTAAmplicon SizecDNA: 259 bpgenomic: 68,981
Reverse (830,21)GAGAGCCTTGCTTTCCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-0.799 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGG
GATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGG
CCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTT
TCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAAT
GGAGGAAAGCAAGGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)259718 - 976
Exon 4 To Exon 6 (Pair 24)
Forward (571,19)CTGACCCTGCCTACCTGCCAmplicon SizecDNA: 262 bpgenomic: 68,984
Reverse (832,21)AAGAGAGCCTTGCTTTCCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-0.799 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAG
GGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGG
GCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGT
TTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAA
TGGAGGAAAGCAAGGCTCTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)262717 - 978
Exon 4 To Exon 6 (Pair 25)
Forward (570,19)GCTGACCCTGCCTACCTGCAmplicon SizecDNA: 258 bpgenomic: 68,980
Reverse (827,21)AGCCTTGCTTTCCTCCATTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.817 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.756 kcal/mol
Reverse Dimers-0.843 kcal/mol
Forward-Reverse Dimers-0.924 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACA
GGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGG
GGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATG
TTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGA
ATGGAGGAAAGCAAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)258716 - 973
Exon 4 To Exon 6 (Pair 26)
Forward (645,23)CCCTTTGACTTACAAAGTGTCATAmplicon SizecDNA: 186 bpgenomic: 68,908
Reverse (830,21)GAGAGCCTTGCTTTCCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAG
AGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTT
AGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAG
GCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)186791 - 976
Exon 4 To Exon 6 (Pair 27)
Forward (572,20)TGACCCTGCCTACCTGCCTAAmplicon SizecDNA: 261 bpgenomic: 68,983
Reverse (832,21)AAGAGAGCCTTGCTTTCCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-0.799 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGG
GATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGG
CCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTT
TCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAAT
GGAGGAAAGCAAGGCTCTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)261718 - 978
Exon 4 To Exon 6 (Pair 28)
Forward (646,24)CCTTTGACTTACAAAGTGTCATTTAmplicon SizecDNA: 186 bpgenomic: 68,908
Reverse (831,21)AGAGAGCCTTGCTTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGA
GAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTA
GTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGG
CTCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)186792 - 977
Exon 4 To Exon 6 (Pair 29)
Forward (592,22)CGCAACAAGATGTGCTTAGAGTAmplicon SizecDNA: 237 bpgenomic: 68,959
Reverse (828,21)GAGCCTTGCTTTCCTCCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.714 kcal/mol
Forward Dimers-0.859 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.865 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTG
ACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAA
AATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAAT
ATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)237738 - 974
Exon 4 To Exon 6 (Pair 30)
Forward (592,22)CGCAACAAGATGTGCTTAGAGTAmplicon SizecDNA: 234 bpgenomic: 68,956
Reverse (825,21)CCTTGCTTTCCTCCATTCGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.714 kcal/mol
Forward Dimers-0.859 kcal/mol
Reverse Loops1.376 kcal/mol in 3' area
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.767 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTG
ACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAA
AATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAAT
ATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)234738 - 971
Exon 4 To Exon 6 (Pair 31)
Forward (572,20)TGACCCTGCCTACCTGCCTAAmplicon SizecDNA: 260 bpgenomic: 68,982
Reverse (831,21)AGAGAGCCTTGCTTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-0.799 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGG
GATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGG
CCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTT
TCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAAT
GGAGGAAAGCAAGGCTCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)260718 - 977
Exon 4 To Exon 6 (Pair 32)
Forward (645,23)CCCTTTGACTTACAAAGTGTCATAmplicon SizecDNA: 188 bpgenomic: 68,910
Reverse (832,21)AAGAGAGCCTTGCTTTCCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAG
AGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTT
AGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAG
GCTCTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)188791 - 978
Exon 4 To Exon 6 (Pair 33)
Forward (645,23)CCCTTTGACTTACAAAGTGTCATAmplicon SizecDNA: 181 bpgenomic: 68,903
Reverse (825,21)CCTTGCTTTCCTCCATTCGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops1.376 kcal/mol in 3' area
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAG
AGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTT
AGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAG
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)181791 - 971
Exon 5 To Exon 6 (Pair 1)
Forward (731,24)AAATGTCACCTCTATCATGTTTCTAmplicon SizecDNA: 100 bpgenomic: 65,895
Reverse (830,21)GAGAGCCTTGCTTTCCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.806 kcal/mol
Forward Dimers-0.252 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.698 kcal/mol
Amplicon Folding0.174 kcal/mol outside primersite
Amplicon SequenceAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGA
GTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)100877 - 976
Exon 5 To Exon 6 (Pair 2)
Forward (731,24)AAATGTCACCTCTATCATGTTTCTAmplicon SizecDNA: 101 bpgenomic: 65,896
Reverse (831,21)AGAGAGCCTTGCTTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.806 kcal/mol
Forward Dimers-0.252 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding0.174 kcal/mol outside primersite
Amplicon SequenceAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGA
GTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCTCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)101877 - 977
 

See below for some more details.

Program Output:

Loading ...