Design Results for gnaq

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 5 (Pair 1)
Forward (497,23)ATGCTATGATAGACGACGAGAATAmplicon SizecDNA: 293 bpgenomic: 21,187
Reverse (789,23)CCACGAGAACTTGATCATATTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGA
CTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCG
AGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAAT
GGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGT
CACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)293643 - 935
Exon 3 To Exon 4 (Pair 1)
Forward (500,23)CTATGATAGACGACGAGAATATCAmplicon SizecDNA: 95 bpgenomic: 18,062
Reverse (594,19)GCGTAGGCAGGTAGGCAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.706 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.95 kcal/mol
Reverse Dimers-0.784 kcal/mol
Forward-Reverse Dimers-2.591 kcal/mol
Amplicon Folding-0.075 kcal/mol outside primersite
Amplicon SequenceCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTT
GGACCGCGTAGCTGACCCTGCCTACCTGCCTACGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)95646 - 740
Exon 3 To Exon 5 (Pair 2)
Forward (500,23)CTATGATAGACGACGAGAATATCAmplicon SizecDNA: 286 bpgenomic: 21,180
Reverse (785,24)GAGAACTTGATCATATTCACTAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.706 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.436 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTT
GGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGT
CCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGT
CGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCAC
CTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)286646 - 931
Exon 3 To Exon 5 (Pair 3)
Forward (497,23)ATGCTATGATAGACGACGAGAATAmplicon SizecDNA: 301 bpgenomic: 21,195
Reverse (797,21)GTCTGACTCCACGAGAACTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGA
CTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCG
AGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAAT
GGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGT
CACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGA
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)301643 - 943
Exon 3 To Exon 5 (Pair 4)
Forward (498,23)TGCTATGATAGACGACGAGAATAAmplicon SizecDNA: 290 bpgenomic: 21,184
Reverse (787,24)ACGAGAACTTGATCATATTCACTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceTGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGAC
TTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGA
GTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATG
GTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTC
ACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)290644 - 933
Exon 3 To Exon 5 (Pair 5)
Forward (500,23)CTATGATAGACGACGAGAATATCAmplicon SizecDNA: 301 bpgenomic: 21,195
Reverse (800,22)ATTGTCTGACTCCACGAGAACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.706 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTT
GGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGT
CCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGT
CGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCAC
CTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAA
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)301646 - 946
Exon 3 To Exon 5 (Pair 6)
Forward (500,23)CTATGATAGACGACGAGAATATCAmplicon SizecDNA: 290 bpgenomic: 21,184
Reverse (789,23)CCACGAGAACTTGATCATATTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.706 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTT
GGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGT
CCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGT
CGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCAC
CTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)290646 - 935
Exon 3 To Exon 5 (Pair 7)
Forward (498,23)TGCTATGATAGACGACGAGAATAAmplicon SizecDNA: 300 bpgenomic: 21,194
Reverse (797,21)GTCTGACTCCACGAGAACTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceTGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGAC
TTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGA
GTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATG
GTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTC
ACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)300644 - 943
Exon 3 To Exon 5 (Pair 8)
Forward (499,23)GCTATGATAGACGACGAGAATATAmplicon SizecDNA: 296 bpgenomic: 21,190
Reverse (794,22)TGACTCCACGAGAACTTGATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACT
TGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAG
TCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGG
TCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCA
CCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)296645 - 940
Exon 3 To Exon 5 (Pair 9)
Forward (500,23)CTATGATAGACGACGAGAATATCAmplicon SizecDNA: 300 bpgenomic: 21,194
Reverse (799,22)TTGTCTGACTCCACGAGAACTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.706 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTT
GGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGT
CCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGT
CGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCAC
CTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)300646 - 945
Exon 3 To Exon 5 (Pair 10)
Forward (497,23)ATGCTATGATAGACGACGAGAATAmplicon SizecDNA: 288 bpgenomic: 21,182
Reverse (784,24)AGAACTTGATCATATTCACTAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.436 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGA
CTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCG
AGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAAT
GGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGT
CACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)288643 - 930
Exon 3 To Exon 4 (Pair 2)
Forward (395,23)TGCACAATTAGTTCGAGAAGTTGAmplicon SizecDNA: 197 bpgenomic: 18,164
Reverse (591,20)TAGGCAGGTAGGCAGGGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.204 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.251 kcal/mol
Amplicon Folding-1.858 kcal/mol outside primersite
Amplicon SequenceTGCACAATTAGTTCGAGAAGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATATGT
AGATGCAATAAAGAGTTTATGGAATGATCCTGGAATCCAGGAATGCTATGATAGACGACG
AGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTTGGACCGCGTAGCTGA
CCCTGCCTACCTGCCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)197541 - 737
Exon 3 To Exon 4 (Pair 3)
Forward (488,23)AATCCAGGAATGCTATGATAGACAmplicon SizecDNA: 80 bpgenomic: 18,047
Reverse (567,22)CGCGGTCCAAGTCATTAAGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.91 kcal/mol
Forward Dimers-1.444 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-2.414 kcal/mol
Forward-Reverse Dimers-1.984 kcal/mol
Amplicon Folding0.877 kcal/mol inside primersite
Amplicon SequenceAATCCAGGAATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTA
TCTTAATGACTTGGACCGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)80634 - 713
Exon 3 To Exon 4 (Pair 4)
Forward (497,23)ATGCTATGATAGACGACGAGAATAmplicon SizecDNA: 121 bpgenomic: 18,088
Reverse (617,23)TCGAACTCTAAGCACATCTTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.798 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.711 kcal/mol
Amplicon Folding-0.376 kcal/mol outside primersite
Amplicon SequenceATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGA
CTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)121643 - 763
Exon 3 To Exon 4 (Pair 5)
Forward (392,23)TCATGCACAATTAGTTCGAGAAGAmplicon SizecDNA: 176 bpgenomic: 18,143
Reverse (567,22)CGCGGTCCAAGTCATTAAGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-1.726 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-2.414 kcal/mol
Forward-Reverse Dimers-1.078 kcal/mol
Amplicon Folding-1.783 kcal/mol outside primersite
Amplicon SequenceTCATGCACAATTAGTTCGAGAAGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATA
TGTAGATGCAATAAAGAGTTTATGGAATGATCCTGGAATCCAGGAATGCTATGATAGACG
ACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTTGGACCGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)176538 - 713
Exon 3 To Exon 4 (Pair 6)
Forward (488,23)AATCCAGGAATGCTATGATAGACAmplicon SizecDNA: 133 bpgenomic: 18,100
Reverse (620,22)GACTCGAACTCTAAGCACATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.91 kcal/mol
Forward Dimers-1.444 kcal/mol
Reverse Loops1.634 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.711 kcal/mol
Amplicon Folding-0.376 kcal/mol outside primersite
Amplicon SequenceAATCCAGGAATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTA
TCTTAATGACTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCT
TAGAGTTCGAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)133634 - 766
Exon 3 To Exon 4 (Pair 7)
Forward (497,23)ATGCTATGATAGACGACGAGAATAmplicon SizecDNA: 98 bpgenomic: 18,065
Reverse (594,19)GCGTAGGCAGGTAGGCAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.95 kcal/mol
Reverse Dimers-0.784 kcal/mol
Forward-Reverse Dimers-2.591 kcal/mol
Amplicon Folding-0.075 kcal/mol outside primersite
Amplicon SequenceATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGA
CTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)98643 - 740
Exon 3 To Exon 4 (Pair 8)
Forward (498,23)TGCTATGATAGACGACGAGAATAAmplicon SizecDNA: 120 bpgenomic: 18,087
Reverse (617,23)TCGAACTCTAAGCACATCTTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.798 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.41 kcal/mol
Amplicon Folding-0.376 kcal/mol outside primersite
Amplicon SequenceTGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGAC
TTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)120644 - 763
Exon 3 To Exon 5 (Pair 11)
Forward (497,23)ATGCTATGATAGACGACGAGAATAmplicon SizecDNA: 298 bpgenomic: 21,192
Reverse (794,22)TGACTCCACGAGAACTTGATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGA
CTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCG
AGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAAT
GGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGT
CACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)298643 - 940
Exon 3 To Exon 4 (Pair 9)
Forward (488,23)AATCCAGGAATGCTATGATAGACAmplicon SizecDNA: 104 bpgenomic: 18,071
Reverse (591,20)TAGGCAGGTAGGCAGGGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.91 kcal/mol
Forward Dimers-1.444 kcal/mol
Reverse Loops1.204 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.298 kcal/mol
Amplicon Folding-0.075 kcal/mol outside primersite
Amplicon SequenceAATCCAGGAATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTA
TCTTAATGACTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)104634 - 737
Exon 3 To Exon 5 (Pair 12)
Forward (497,23)ATGCTATGATAGACGACGAGAATAmplicon SizecDNA: 291 bpgenomic: 21,185
Reverse (787,24)ACGAGAACTTGATCATATTCACTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGA
CTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCG
AGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAAT
GGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGT
CACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)291643 - 933
Exon 3 To Exon 5 (Pair 13)
Forward (498,23)TGCTATGATAGACGACGAGAATAAmplicon SizecDNA: 287 bpgenomic: 21,181
Reverse (784,24)AGAACTTGATCATATTCACTAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.436 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceTGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGAC
TTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGA
GTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATG
GTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTC
ACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)287644 - 930
Exon 3 To Exon 5 (Pair 14)
Forward (498,23)TGCTATGATAGACGACGAGAATAAmplicon SizecDNA: 297 bpgenomic: 21,191
Reverse (794,22)TGACTCCACGAGAACTTGATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceTGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGAC
TTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGA
GTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATG
GTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTC
ACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)297644 - 940
Exon 3 To Exon 4 (Pair 10)
Forward (392,23)TCATGCACAATTAGTTCGAGAAGAmplicon SizecDNA: 200 bpgenomic: 18,167
Reverse (591,20)TAGGCAGGTAGGCAGGGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-1.726 kcal/mol
Reverse Loops1.204 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.552 kcal/mol
Amplicon Folding-1.858 kcal/mol outside primersite
Amplicon SequenceTCATGCACAATTAGTTCGAGAAGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATA
TGTAGATGCAATAAAGAGTTTATGGAATGATCCTGGAATCCAGGAATGCTATGATAGACG
ACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTTGGACCGCGTAGC
TGACCCTGCCTACCTGCCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)200538 - 737
Exon 3 To Exon 5 (Pair 15)
Forward (499,23)GCTATGATAGACGACGAGAATATAmplicon SizecDNA: 289 bpgenomic: 21,183
Reverse (787,24)ACGAGAACTTGATCATATTCACTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACT
TGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAG
TCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGG
TCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCA
CCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)289645 - 933
Exon 3 To Exon 4 (Pair 11)
Forward (499,23)GCTATGATAGACGACGAGAATATAmplicon SizecDNA: 96 bpgenomic: 18,063
Reverse (594,19)GCGTAGGCAGGTAGGCAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.95 kcal/mol
Reverse Dimers-0.784 kcal/mol
Forward-Reverse Dimers-2.591 kcal/mol
Amplicon Folding-0.075 kcal/mol outside primersite
Amplicon SequenceGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACT
TGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)96645 - 740
Exon 3 To Exon 5 (Pair 16)
Forward (498,23)TGCTATGATAGACGACGAGAATAAmplicon SizecDNA: 296 bpgenomic: 21,190
Reverse (793,22)GACTCCACGAGAACTTGATCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceTGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGAC
TTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGA
GTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATG
GTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTC
ACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)296644 - 939
Exon 3 To Exon 5 (Pair 17)
Forward (498,23)TGCTATGATAGACGACGAGAATAAmplicon SizecDNA: 291 bpgenomic: 21,185
Reverse (788,23)CACGAGAACTTGATCATATTCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceTGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGAC
TTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGA
GTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATG
GTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTC
ACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)291644 - 934
Exon 3 To Exon 5 (Pair 18)
Forward (500,23)CTATGATAGACGACGAGAATATCAmplicon SizecDNA: 297 bpgenomic: 21,191
Reverse (796,22)TCTGACTCCACGAGAACTTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.706 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTT
GGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGT
CCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGT
CGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCAC
CTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)297646 - 942
Exon 3 To Exon 5 (Pair 19)
Forward (499,23)GCTATGATAGACGACGAGAATATAmplicon SizecDNA: 301 bpgenomic: 21,195
Reverse (799,22)TTGTCTGACTCCACGAGAACTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACT
TGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAG
TCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGG
TCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCA
CCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACA
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)301645 - 945
Exon 3 To Exon 5 (Pair 20)
Forward (500,23)CTATGATAGACGACGAGAATATCAmplicon SizecDNA: 294 bpgenomic: 21,188
Reverse (793,22)GACTCCACGAGAACTTGATCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.706 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTT
GGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGT
CCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGT
CGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCAC
CTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)294646 - 939
Exon 3 To Exon 5 (Pair 21)
Forward (497,23)ATGCTATGATAGACGACGAGAATAmplicon SizecDNA: 289 bpgenomic: 21,183
Reverse (785,24)GAGAACTTGATCATATTCACTAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.436 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGA
CTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCG
AGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAAT
GGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGT
CACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)289643 - 931
Exon 3 To Exon 5 (Pair 22)
Forward (500,23)CTATGATAGACGACGAGAATATCAmplicon SizecDNA: 288 bpgenomic: 21,182
Reverse (787,24)ACGAGAACTTGATCATATTCACTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.706 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTT
GGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGT
CCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGT
CGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCAC
CTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)288646 - 933
Exon 3 To Exon 5 (Pair 23)
Forward (498,23)TGCTATGATAGACGACGAGAATAAmplicon SizecDNA: 299 bpgenomic: 21,193
Reverse (796,22)TCTGACTCCACGAGAACTTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceTGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGAC
TTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGA
GTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATG
GTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTC
ACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)299644 - 942
Exon 3 To Exon 4 (Pair 12)
Forward (488,23)AATCCAGGAATGCTATGATAGACAmplicon SizecDNA: 131 bpgenomic: 18,098
Reverse (618,22)CTCGAACTCTAAGCACATCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.91 kcal/mol
Forward Dimers-1.444 kcal/mol
Reverse Loops1.104 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.711 kcal/mol
Amplicon Folding-0.376 kcal/mol outside primersite
Amplicon SequenceAATCCAGGAATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTA
TCTTAATGACTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCT
TAGAGTTCGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)131634 - 764
Exon 3 To Exon 5 (Pair 24)
Forward (498,23)TGCTATGATAGACGACGAGAATAAmplicon SizecDNA: 292 bpgenomic: 21,186
Reverse (789,23)CCACGAGAACTTGATCATATTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceTGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGAC
TTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGA
GTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATG
GTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTC
ACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)292644 - 935
Exon 3 To Exon 4 (Pair 13)
Forward (488,23)AATCCAGGAATGCTATGATAGACAmplicon SizecDNA: 130 bpgenomic: 18,097
Reverse (617,23)TCGAACTCTAAGCACATCTTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.91 kcal/mol
Forward Dimers-1.444 kcal/mol
Reverse Loops0.798 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.711 kcal/mol
Amplicon Folding-0.376 kcal/mol outside primersite
Amplicon SequenceAATCCAGGAATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTA
TCTTAATGACTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCT
TAGAGTTCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)130634 - 763
Exon 3 To Exon 5 (Pair 25)
Forward (499,23)GCTATGATAGACGACGAGAATATAmplicon SizecDNA: 298 bpgenomic: 21,192
Reverse (796,22)TCTGACTCCACGAGAACTTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACT
TGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAG
TCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGG
TCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCA
CCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)298645 - 942
Exon 3 To Exon 4 (Pair 14)
Forward (498,23)TGCTATGATAGACGACGAGAATAAmplicon SizecDNA: 97 bpgenomic: 18,064
Reverse (594,19)GCGTAGGCAGGTAGGCAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.95 kcal/mol
Reverse Dimers-0.784 kcal/mol
Forward-Reverse Dimers-2.591 kcal/mol
Amplicon Folding-0.075 kcal/mol outside primersite
Amplicon SequenceTGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGAC
TTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)97644 - 740
Exon 3 To Exon 5 (Pair 26)
Forward (500,23)CTATGATAGACGACGAGAATATCAmplicon SizecDNA: 287 bpgenomic: 21,181
Reverse (786,24)CGAGAACTTGATCATATTCACTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.706 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.436 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTT
GGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGT
CCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGT
CGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCAC
CTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)287646 - 932
Exon 3 To Exon 5 (Pair 27)
Forward (499,23)GCTATGATAGACGACGAGAATATAmplicon SizecDNA: 290 bpgenomic: 21,184
Reverse (788,23)CACGAGAACTTGATCATATTCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACT
TGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAG
TCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGG
TCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCA
CCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)290645 - 934
Exon 3 To Exon 5 (Pair 28)
Forward (499,23)GCTATGATAGACGACGAGAATATAmplicon SizecDNA: 286 bpgenomic: 21,180
Reverse (784,24)AGAACTTGATCATATTCACTAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.436 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACT
TGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAG
TCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGG
TCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCA
CCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)286645 - 930
Exon 3 To Exon 5 (Pair 29)
Forward (498,23)TGCTATGATAGACGACGAGAATAAmplicon SizecDNA: 288 bpgenomic: 21,182
Reverse (785,24)GAGAACTTGATCATATTCACTAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.436 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceTGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGAC
TTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGA
GTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATG
GTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTC
ACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)288644 - 931
Exon 3 To Exon 5 (Pair 30)
Forward (497,23)ATGCTATGATAGACGACGAGAATAmplicon SizecDNA: 292 bpgenomic: 21,186
Reverse (788,23)CACGAGAACTTGATCATATTCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGA
CTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCG
AGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAAT
GGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGT
CACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)292643 - 934
Exon 3 To Exon 5 (Pair 31)
Forward (500,23)CTATGATAGACGACGAGAATATCAmplicon SizecDNA: 285 bpgenomic: 21,179
Reverse (784,24)AGAACTTGATCATATTCACTAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.706 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.436 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTT
GGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGT
CCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGT
CGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCAC
CTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)285646 - 930
Exon 3 To Exon 5 (Pair 32)
Forward (500,23)CTATGATAGACGACGAGAATATCAmplicon SizecDNA: 289 bpgenomic: 21,183
Reverse (788,23)CACGAGAACTTGATCATATTCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.706 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTT
GGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGT
CCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGT
CGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCAC
CTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)289646 - 934
Exon 3 To Exon 5 (Pair 33)
Forward (500,23)CTATGATAGACGACGAGAATATCAmplicon SizecDNA: 298 bpgenomic: 21,192
Reverse (797,21)GTCTGACTCCACGAGAACTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.706 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTT
GGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGT
CCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGT
CGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCAC
CTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)298646 - 943
Exon 3 To Exon 5 (Pair 34)
Forward (497,23)ATGCTATGATAGACGACGAGAATAmplicon SizecDNA: 290 bpgenomic: 21,184
Reverse (786,24)CGAGAACTTGATCATATTCACTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.436 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGA
CTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCG
AGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAAT
GGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGT
CACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)290643 - 932
Exon 3 To Exon 4 (Pair 15)
Forward (500,23)CTATGATAGACGACGAGAATATCAmplicon SizecDNA: 118 bpgenomic: 18,085
Reverse (617,23)TCGAACTCTAAGCACATCTTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.706 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.798 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.376 kcal/mol outside primersite
Amplicon SequenceCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTT
GGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)118646 - 763
Exon 3 To Exon 5 (Pair 35)
Forward (499,23)GCTATGATAGACGACGAGAATATAmplicon SizecDNA: 288 bpgenomic: 21,182
Reverse (786,24)CGAGAACTTGATCATATTCACTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.436 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACT
TGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAG
TCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGG
TCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCA
CCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)288645 - 932
Exon 3 To Exon 4 (Pair 16)
Forward (393,23)CATGCACAATTAGTTCGAGAAGTAmplicon SizecDNA: 175 bpgenomic: 18,142
Reverse (567,22)CGCGGTCCAAGTCATTAAGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-1.726 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-2.414 kcal/mol
Forward-Reverse Dimers-1.078 kcal/mol
Amplicon Folding-1.783 kcal/mol outside primersite
Amplicon SequenceCATGCACAATTAGTTCGAGAAGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATAT
GTAGATGCAATAAAGAGTTTATGGAATGATCCTGGAATCCAGGAATGCTATGATAGACGA
CGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTTGGACCGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)175539 - 713
Exon 3 To Exon 5 (Pair 36)
Forward (499,23)GCTATGATAGACGACGAGAATATAmplicon SizecDNA: 295 bpgenomic: 21,189
Reverse (793,22)GACTCCACGAGAACTTGATCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACT
TGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAG
TCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGG
TCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCA
CCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)295645 - 939
Exon 3 To Exon 4 (Pair 17)
Forward (393,23)CATGCACAATTAGTTCGAGAAGTAmplicon SizecDNA: 199 bpgenomic: 18,166
Reverse (591,20)TAGGCAGGTAGGCAGGGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-1.726 kcal/mol
Reverse Loops1.204 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.552 kcal/mol
Amplicon Folding-1.858 kcal/mol outside primersite
Amplicon SequenceCATGCACAATTAGTTCGAGAAGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATAT
GTAGATGCAATAAAGAGTTTATGGAATGATCCTGGAATCCAGGAATGCTATGATAGACGA
CGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTTGGACCGCGTAGCT
GACCCTGCCTACCTGCCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)199539 - 737
Exon 3 To Exon 5 (Pair 37)
Forward (500,23)CTATGATAGACGACGAGAATATCAmplicon SizecDNA: 295 bpgenomic: 21,189
Reverse (794,22)TGACTCCACGAGAACTTGATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.706 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTT
GGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGT
CCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGT
CGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCAC
CTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)295646 - 940
Exon 3 To Exon 5 (Pair 38)
Forward (499,23)GCTATGATAGACGACGAGAATATAmplicon SizecDNA: 299 bpgenomic: 21,193
Reverse (797,21)GTCTGACTCCACGAGAACTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACT
TGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAG
TCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGG
TCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCA
CCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)299645 - 943
Exon 3 To Exon 5 (Pair 39)
Forward (498,23)TGCTATGATAGACGACGAGAATAAmplicon SizecDNA: 289 bpgenomic: 21,183
Reverse (786,24)CGAGAACTTGATCATATTCACTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.436 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceTGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGAC
TTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGA
GTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATG
GTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTC
ACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)289644 - 932
Exon 3 To Exon 5 (Pair 40)
Forward (499,23)GCTATGATAGACGACGAGAATATAmplicon SizecDNA: 291 bpgenomic: 21,185
Reverse (789,23)CCACGAGAACTTGATCATATTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACT
TGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAG
TCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGG
TCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCA
CCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)291645 - 935
Exon 3 To Exon 4 (Pair 18)
Forward (497,23)ATGCTATGATAGACGACGAGAATAmplicon SizecDNA: 95 bpgenomic: 18,062
Reverse (591,20)TAGGCAGGTAGGCAGGGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.204 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.298 kcal/mol
Amplicon Folding-0.075 kcal/mol outside primersite
Amplicon SequenceATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGA
CTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)95643 - 737
Exon 3 To Exon 4 (Pair 19)
Forward (395,23)TGCACAATTAGTTCGAGAAGTTGAmplicon SizecDNA: 173 bpgenomic: 18,140
Reverse (567,22)CGCGGTCCAAGTCATTAAGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-2.414 kcal/mol
Forward-Reverse Dimers-1.078 kcal/mol
Amplicon Folding-1.783 kcal/mol outside primersite
Amplicon SequenceTGCACAATTAGTTCGAGAAGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATATGT
AGATGCAATAAAGAGTTTATGGAATGATCCTGGAATCCAGGAATGCTATGATAGACGACG
AGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTTGGACCGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)173541 - 713
Exon 3 To Exon 5 (Pair 41)
Forward (497,23)ATGCTATGATAGACGACGAGAATAmplicon SizecDNA: 297 bpgenomic: 21,191
Reverse (793,22)GACTCCACGAGAACTTGATCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGA
CTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCG
AGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAAT
GGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGT
CACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)297643 - 939
Exon 3 To Exon 5 (Pair 42)
Forward (499,23)GCTATGATAGACGACGAGAATATAmplicon SizecDNA: 287 bpgenomic: 21,181
Reverse (785,24)GAGAACTTGATCATATTCACTAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.901 kcal/mol
Reverse Dimers-1.436 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACT
TGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAG
TCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGG
TCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCA
CCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)287645 - 931
Exon 3 To Exon 4 (Pair 20)
Forward (498,23)TGCTATGATAGACGACGAGAATAAmplicon SizecDNA: 94 bpgenomic: 18,061
Reverse (591,20)TAGGCAGGTAGGCAGGGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops1.204 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-0.997 kcal/mol
Amplicon Folding-0.075 kcal/mol outside primersite
Amplicon SequenceTGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGAC
TTGGACCGCGTAGCTGACCCTGCCTACCTGCCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)94644 - 737
Exon 3 To Exon 5 (Pair 43)
Forward (497,23)ATGCTATGATAGACGACGAGAATAmplicon SizecDNA: 300 bpgenomic: 21,194
Reverse (796,22)TCTGACTCCACGAGAACTTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.648 kcal/mol outside primersite
Amplicon SequenceATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGA
CTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCG
AGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAAT
GGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGT
CACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)300643 - 942
Exon 3 To Exon 4 (Pair 21)
Forward (499,23)GCTATGATAGACGACGAGAATATAmplicon SizecDNA: 119 bpgenomic: 18,086
Reverse (617,23)TCGAACTCTAAGCACATCTTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-2.288 kcal/mol
Reverse Loops0.798 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.376 kcal/mol outside primersite
Amplicon SequenceGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACT
TGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)119645 - 763
Exon 4 To Exon 6 (Pair 1)
Forward (568,20)TAGCTGACCCTGCCTACCTGAmplicon SizecDNA: 265 bpgenomic: 68,987
Reverse (832,21)AAGAGAGCCTTGCTTTCCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.963 kcal/mol
Forward Dimers-2.064 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.814 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCA
CAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAG
GGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCA
TGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACC
GAATGGAGGAAAGCAAGGCTCTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)265714 - 978
Exon 4 To Exon 6 (Pair 2)
Forward (592,22)CGCAACAAGATGTGCTTAGAGTAmplicon SizecDNA: 239 bpgenomic: 68,961
Reverse (830,21)GAGAGCCTTGCTTTCCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.714 kcal/mol
Forward Dimers-0.859 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.865 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTG
ACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAA
AATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAAT
ATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)239738 - 976
Exon 4 To Exon 6 (Pair 3)
Forward (646,24)CCTTTGACTTACAAAGTGTCATTTAmplicon SizecDNA: 185 bpgenomic: 68,907
Reverse (830,21)GAGAGCCTTGCTTTCCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGA
GAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTA
GTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGG
CTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)185792 - 976
Exon 4 To Exon 6 (Pair 4)
Forward (568,20)TAGCTGACCCTGCCTACCTGAmplicon SizecDNA: 258 bpgenomic: 68,980
Reverse (825,21)CCTTGCTTTCCTCCATTCGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.963 kcal/mol
Forward Dimers-2.064 kcal/mol
Reverse Loops1.376 kcal/mol in 3' area
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.565 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCA
CAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAG
GGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCA
TGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACC
GAATGGAGGAAAGCAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)258714 - 971
Exon 4 To Exon 6 (Pair 5)
Forward (645,23)CCCTTTGACTTACAAAGTGTCATAmplicon SizecDNA: 294 bpgenomic: 69,016
Reverse (938,22)GTCGACTAGATGGGAATACATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-2.506 kcal/mol
Forward-Reverse Dimers-1.822 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAG
AGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTT
AGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAG
GCTCTCTTTAGAACAATTATCACATACCCCTGGTTCCAGAACTCCTCGGTTATTCTGTTC
TTAAACAAGAAAGATCTTCTAGAGGAGAAAATCATGTATTCCCATCTAGTCGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)294791 - 1084
Exon 4 To Exon 6 (Pair 6)
Forward (567,20)GTAGCTGACCCTGCCTACCTAmplicon SizecDNA: 259 bpgenomic: 68,981
Reverse (825,21)CCTTGCTTTCCTCCATTCGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.963 kcal/mol
Forward Dimers-2.064 kcal/mol
Reverse Loops1.376 kcal/mol in 3' area
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.565 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACC
ACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTA
GGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATC
ATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAAC
CGAATGGAGGAAAGCAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)259713 - 971
Exon 4 To Exon 6 (Pair 7)
Forward (592,22)CGCAACAAGATGTGCTTAGAGTAmplicon SizecDNA: 236 bpgenomic: 68,958
Reverse (827,21)AGCCTTGCTTTCCTCCATTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.714 kcal/mol
Forward Dimers-0.859 kcal/mol
Reverse Loops0.756 kcal/mol
Reverse Dimers-0.843 kcal/mol
Forward-Reverse Dimers-1.767 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTG
ACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAA
AATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAAT
ATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)236738 - 973
Exon 4 To Exon 6 (Pair 8)
Forward (568,20)TAGCTGACCCTGCCTACCTGAmplicon SizecDNA: 264 bpgenomic: 68,986
Reverse (831,21)AGAGAGCCTTGCTTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.963 kcal/mol
Forward Dimers-2.064 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.814 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCA
CAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAG
GGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCA
TGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACC
GAATGGAGGAAAGCAAGGCTCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)264714 - 977
Exon 4 To Exon 6 (Pair 9)
Forward (570,19)GCTGACCCTGCCTACCTGCAmplicon SizecDNA: 259 bpgenomic: 68,981
Reverse (828,21)GAGCCTTGCTTTCCTCCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.817 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.487 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACA
GGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGG
GGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATG
TTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGA
ATGGAGGAAAGCAAGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)259716 - 974
Exon 4 To Exon 6 (Pair 10)
Forward (570,19)GCTGACCCTGCCTACCTGCAmplicon SizecDNA: 261 bpgenomic: 68,983
Reverse (830,21)GAGAGCCTTGCTTTCCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.817 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.487 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACA
GGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGG
GGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATG
TTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGA
ATGGAGGAAAGCAAGGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)261716 - 976
Exon 4 To Exon 6 (Pair 11)
Forward (646,24)CCTTTGACTTACAAAGTGTCATTTAmplicon SizecDNA: 186 bpgenomic: 68,908
Reverse (831,21)AGAGAGCCTTGCTTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGA
GAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTA
GTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGG
CTCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)186792 - 977
Exon 4 To Exon 6 (Pair 12)
Forward (646,24)CCTTTGACTTACAAAGTGTCATTTAmplicon SizecDNA: 183 bpgenomic: 68,905
Reverse (828,21)GAGCCTTGCTTTCCTCCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGA
GAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTA
GTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGG
CTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)183792 - 974
Exon 4 To Exon 6 (Pair 13)
Forward (571,19)CTGACCCTGCCTACCTGCCAmplicon SizecDNA: 258 bpgenomic: 68,980
Reverse (828,21)GAGCCTTGCTTTCCTCCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-0.38 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAG
GGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGG
GCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGT
TTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAA
TGGAGGAAAGCAAGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)258717 - 974
Exon 4 To Exon 6 (Pair 14)
Forward (645,23)CCCTTTGACTTACAAAGTGTCATAmplicon SizecDNA: 183 bpgenomic: 68,905
Reverse (827,21)AGCCTTGCTTTCCTCCATTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.756 kcal/mol
Reverse Dimers-0.843 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAG
AGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTT
AGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAG
GCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)183791 - 973
Exon 4 To Exon 6 (Pair 15)
Forward (568,20)TAGCTGACCCTGCCTACCTGAmplicon SizecDNA: 263 bpgenomic: 68,985
Reverse (830,21)GAGAGCCTTGCTTTCCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.963 kcal/mol
Forward Dimers-2.064 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.814 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCA
CAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAG
GGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCA
TGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACC
GAATGGAGGAAAGCAAGGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)263714 - 976
Exon 4 To Exon 6 (Pair 16)
Forward (646,24)CCTTTGACTTACAAAGTGTCATTTAmplicon SizecDNA: 187 bpgenomic: 68,909
Reverse (832,21)AAGAGAGCCTTGCTTTCCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGA
GAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTA
GTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGG
CTCTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)187792 - 978
Exon 4 To Exon 6 (Pair 17)
Forward (568,20)TAGCTGACCCTGCCTACCTGAmplicon SizecDNA: 261 bpgenomic: 68,983
Reverse (828,21)GAGCCTTGCTTTCCTCCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.963 kcal/mol
Forward Dimers-2.064 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.814 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCA
CAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAG
GGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCA
TGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACC
GAATGGAGGAAAGCAAGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)261714 - 974
Exon 4 To Exon 6 (Pair 18)
Forward (567,20)GTAGCTGACCCTGCCTACCTAmplicon SizecDNA: 262 bpgenomic: 68,984
Reverse (828,21)GAGCCTTGCTTTCCTCCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.963 kcal/mol
Forward Dimers-2.064 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.814 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACC
ACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTA
GGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATC
ATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAAC
CGAATGGAGGAAAGCAAGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)262713 - 974
Exon 4 To Exon 6 (Pair 19)
Forward (572,20)TGACCCTGCCTACCTGCCTAAmplicon SizecDNA: 260 bpgenomic: 68,982
Reverse (831,21)AGAGAGCCTTGCTTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-0.799 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGG
GATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGG
CCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTT
TCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAAT
GGAGGAAAGCAAGGCTCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)260718 - 977
Exon 4 To Exon 6 (Pair 20)
Forward (645,23)CCCTTTGACTTACAAAGTGTCATAmplicon SizecDNA: 181 bpgenomic: 68,903
Reverse (825,21)CCTTGCTTTCCTCCATTCGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops1.376 kcal/mol in 3' area
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAG
AGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTT
AGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAG
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)181791 - 971
Exon 4 To Exon 6 (Pair 21)
Forward (646,24)CCTTTGACTTACAAAGTGTCATTTAmplicon SizecDNA: 180 bpgenomic: 68,902
Reverse (825,21)CCTTGCTTTCCTCCATTCGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops1.376 kcal/mol in 3' area
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGA
GAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTA
GTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)180792 - 971
Exon 4 To Exon 6 (Pair 22)
Forward (572,20)TGACCCTGCCTACCTGCCTAAmplicon SizecDNA: 257 bpgenomic: 68,979
Reverse (828,21)GAGCCTTGCTTTCCTCCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-0.38 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGG
GATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGG
CCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTT
TCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAAT
GGAGGAAAGCAAGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)257718 - 974
Exon 4 To Exon 6 (Pair 23)
Forward (571,19)CTGACCCTGCCTACCTGCCAmplicon SizecDNA: 257 bpgenomic: 68,979
Reverse (827,21)AGCCTTGCTTTCCTCCATTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.756 kcal/mol
Reverse Dimers-0.843 kcal/mol
Forward-Reverse Dimers-0.38 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAG
GGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGG
GCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGT
TTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAA
TGGAGGAAAGCAAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)257717 - 973
Exon 4 To Exon 6 (Pair 24)
Forward (645,23)CCCTTTGACTTACAAAGTGTCATAmplicon SizecDNA: 184 bpgenomic: 68,906
Reverse (828,21)GAGCCTTGCTTTCCTCCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAG
AGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTT
AGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAG
GCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)184791 - 974
Exon 4 To Exon 6 (Pair 25)
Forward (646,24)CCTTTGACTTACAAAGTGTCATTTAmplicon SizecDNA: 293 bpgenomic: 69,015
Reverse (938,22)GTCGACTAGATGGGAATACATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-2.506 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGA
GAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTA
GTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGG
CTCTCTTTAGAACAATTATCACATACCCCTGGTTCCAGAACTCCTCGGTTATTCTGTTCT
TAAACAAGAAAGATCTTCTAGAGGAGAAAATCATGTATTCCCATCTAGTCGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)293792 - 1084
Exon 4 To Exon 6 (Pair 26)
Forward (571,19)CTGACCCTGCCTACCTGCCAmplicon SizecDNA: 260 bpgenomic: 68,982
Reverse (830,21)GAGAGCCTTGCTTTCCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-0.799 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAG
GGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGG
GCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGT
TTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAA
TGGAGGAAAGCAAGGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)260717 - 976
Exon 4 To Exon 6 (Pair 27)
Forward (567,20)GTAGCTGACCCTGCCTACCTAmplicon SizecDNA: 265 bpgenomic: 68,987
Reverse (831,21)AGAGAGCCTTGCTTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.963 kcal/mol
Forward Dimers-2.064 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.814 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACC
ACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTA
GGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATC
ATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAAC
CGAATGGAGGAAAGCAAGGCTCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)265713 - 977
Exon 4 To Exon 6 (Pair 28)
Forward (567,20)GTAGCTGACCCTGCCTACCTAmplicon SizecDNA: 266 bpgenomic: 68,988
Reverse (832,21)AAGAGAGCCTTGCTTTCCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.963 kcal/mol
Forward Dimers-2.064 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.814 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACC
ACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTA
GGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATC
ATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAAC
CGAATGGAGGAAAGCAAGGCTCTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)266713 - 978
Exon 4 To Exon 6 (Pair 29)
Forward (570,19)GCTGACCCTGCCTACCTGCAmplicon SizecDNA: 263 bpgenomic: 68,985
Reverse (832,21)AAGAGAGCCTTGCTTTCCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.817 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.487 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACA
GGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGG
GGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATG
TTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGA
ATGGAGGAAAGCAAGGCTCTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)263716 - 978
Exon 4 To Exon 6 (Pair 30)
Forward (646,24)CCTTTGACTTACAAAGTGTCATTTAmplicon SizecDNA: 182 bpgenomic: 68,904
Reverse (827,21)AGCCTTGCTTTCCTCCATTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.756 kcal/mol
Reverse Dimers-0.843 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGA
GAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTA
GTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGG
CT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)182792 - 973
Exon 4 To Exon 6 (Pair 31)
Forward (645,23)CCCTTTGACTTACAAAGTGTCATAmplicon SizecDNA: 187 bpgenomic: 68,909
Reverse (831,21)AGAGAGCCTTGCTTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAG
AGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTT
AGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAG
GCTCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)187791 - 977
Exon 4 To Exon 6 (Pair 32)
Forward (592,22)CGCAACAAGATGTGCTTAGAGTAmplicon SizecDNA: 241 bpgenomic: 68,963
Reverse (832,21)AAGAGAGCCTTGCTTTCCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.714 kcal/mol
Forward Dimers-0.859 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.865 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceCGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTG
ACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAA
AATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAAT
ATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCTCTCT
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)241738 - 978
Exon 4 To Exon 6 (Pair 33)
Forward (572,20)TGACCCTGCCTACCTGCCTAAmplicon SizecDNA: 259 bpgenomic: 68,981
Reverse (830,21)GAGAGCCTTGCTTTCCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-0.799 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGG
GATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGG
CCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTT
TCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAAT
GGAGGAAAGCAAGGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)259718 - 976
Exon 4 To Exon 6 (Pair 34)
Forward (645,23)CCCTTTGACTTACAAAGTGTCATAmplicon SizecDNA: 186 bpgenomic: 68,908
Reverse (830,21)GAGAGCCTTGCTTTCCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-1.691 kcal/mol
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-1.276 kcal/mol
Amplicon Folding0.062 kcal/mol outside primersite
Amplicon SequenceCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAG
AGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTT
AGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAG
GCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)186791 - 976
Exon 4 To Exon 6 (Pair 35)
Forward (572,20)TGACCCTGCCTACCTGCCTAAmplicon SizecDNA: 261 bpgenomic: 68,983
Reverse (832,21)AAGAGAGCCTTGCTTTCCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.698 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.193 kcal/mol
Reverse Dimers-1.406 kcal/mol
Forward-Reverse Dimers-0.799 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGG
GATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGG
CCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTT
TCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAAT
GGAGGAAAGCAAGGCTCTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)261718 - 978
Exon 4 To Exon 6 (Pair 36)
Forward (568,20)TAGCTGACCCTGCCTACCTGAmplicon SizecDNA: 260 bpgenomic: 68,982
Reverse (827,21)AGCCTTGCTTTCCTCCATTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.963 kcal/mol
Forward Dimers-2.064 kcal/mol
Reverse Loops0.756 kcal/mol
Reverse Dimers-0.843 kcal/mol
Forward-Reverse Dimers-1.565 kcal/mol
Amplicon Folding-0.272 kcal/mol outside primersite
Amplicon SequenceTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCA
CAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAG
GGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCA
TGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACC
GAATGGAGGAAAGCAAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002072 (GNAQ)260714 - 973
 

See below for some more details.

Program Output:

Loading ...