Design Results for ibsp

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-0.7 Minimal dG for amplicon folding-0.7
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 5 To Exon 6 (Pair 1)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 114 bpgenomic: 4,535
Reverse (433,22)AGTGTTGTAGCAGAAAGTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)114320 - 433
Exon 5 To Exon 6 (Pair 2)
Forward (317,21)CAGTTCAGAAGAGGAGGAGGAAmplicon SizecDNA: 115 bpgenomic: 4,536
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.197 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGA
ATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)115317 - 431
Exon 5 To Exon 6 (Pair 3)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 111 bpgenomic: 4,532
Reverse (432,22)GTGTTGTAGCAGAAAGTGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0.468 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001198632 (RUNX1T1)5963635 - 6597
NM_001198626 (RUNX1T1)5963861 - 6823
NM_175636 (RUNX1T1)5963553 - 6515
NM_004349 (RUNX1T1)5963654 - 6616
NM_001198679 (RUNX1T1)5963688 - 6650
NM_001198627 (RUNX1T1)5963921 - 6883
NM_001198634 (RUNX1T1)5963544 - 6506
NM_175634 (RUNX1T1)5963779 - 6741
NM_001198630 (RUNX1T1)5963704 - 6666
NM_004967 (IBSP)111322 - 432
NM_175635 (RUNX1T1)5963471 - 6433
NM_001198631 (RUNX1T1)5963717 - 6679
NM_001198625 (RUNX1T1)59631003 - 6965
NM_001198633 (RUNX1T1)5963606 - 6568
NM_001198628 (RUNX1T1)5963518 - 6480
NM_001198629 (RUNX1T1)5963644 - 6606
Exon 5 To Exon 6 (Pair 4)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 112 bpgenomic: 4,533
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)112320 - 431
Exon 5 To Exon 6 (Pair 5)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 114 bpgenomic: 4,535
Reverse (432,22)GTGTTGTAGCAGAAAGTGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)114319 - 432
Exon 5 To Exon 6 (Pair 6)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 113 bpgenomic: 4,534
Reverse (432,22)GTGTTGTAGCAGAAAGTGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)113320 - 432
Exon 5 To Exon 6 (Pair 7)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 110 bpgenomic: 4,531
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0.468 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)110322 - 431
Exon 5 To Exon 6 (Pair 8)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 113 bpgenomic: 4,534
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)113319 - 431
Exon 5 To Exon 6 (Pair 9)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 115 bpgenomic: 4,536
Reverse (434,22)CAGTGTTGTAGCAGAAAGTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)115320 - 434
Exon 5 To Exon 6 (Pair 10)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 112 bpgenomic: 4,533
Reverse (433,22)AGTGTTGTAGCAGAAAGTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0.468 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001198632 (RUNX1T1)5963635 - 6597
NM_001198626 (RUNX1T1)5963861 - 6823
NM_175636 (RUNX1T1)5963553 - 6515
NM_004349 (RUNX1T1)5963654 - 6616
NM_001198679 (RUNX1T1)5963688 - 6650
NM_001198627 (RUNX1T1)5963921 - 6883
NM_001198634 (RUNX1T1)5963544 - 6506
NM_175634 (RUNX1T1)5963779 - 6741
NM_001198630 (RUNX1T1)5963704 - 6666
NM_004967 (IBSP)112322 - 433
NM_175635 (RUNX1T1)5963471 - 6433
NM_001198631 (RUNX1T1)5963717 - 6679
NM_001198625 (RUNX1T1)59631003 - 6965
NM_001198633 (RUNX1T1)5963606 - 6568
NM_001198628 (RUNX1T1)5963518 - 6480
NM_001198629 (RUNX1T1)5963644 - 6606
Exon 5 To Exon 6 (Pair 11)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 116 bpgenomic: 4,537
Reverse (434,22)CAGTGTTGTAGCAGAAAGTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)116319 - 434
Exon 5 To Exon 6 (Pair 12)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 113 bpgenomic: 4,534
Reverse (434,22)CAGTGTTGTAGCAGAAAGTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0.468 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001198632 (RUNX1T1)5963635 - 6597
NM_001198626 (RUNX1T1)5963861 - 6823
NM_175636 (RUNX1T1)5963553 - 6515
NM_004349 (RUNX1T1)5963654 - 6616
NM_001198679 (RUNX1T1)5963688 - 6650
NM_001198627 (RUNX1T1)5963921 - 6883
NM_001198634 (RUNX1T1)5963544 - 6506
NM_175634 (RUNX1T1)5963779 - 6741
NM_001198630 (RUNX1T1)5963704 - 6666
NM_004967 (IBSP)113322 - 434
NM_175635 (RUNX1T1)5963471 - 6433
NM_001198631 (RUNX1T1)5963717 - 6679
NM_001198625 (RUNX1T1)59631003 - 6965
NM_001198633 (RUNX1T1)5963606 - 6568
NM_001198628 (RUNX1T1)5963518 - 6480
NM_001198629 (RUNX1T1)5963644 - 6606
Exon 5 To Exon 6 (Pair 13)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 115 bpgenomic: 4,536
Reverse (433,22)AGTGTTGTAGCAGAAAGTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)115319 - 433
Exon 5 To Exon 6 (Pair 14)
Forward (317,21)CAGTTCAGAAGAGGAGGAGGAAmplicon SizecDNA: 116 bpgenomic: 4,537
Reverse (432,22)GTGTTGTAGCAGAAAGTGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.197 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGA
ATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)116317 - 432
 

See below for some more details.

Program Output:

Loading ...