Design Results for ibsp

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-2 Minimal dG for amplicon folding-2
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 4 To Exon 6 (Pair 1)
Forward (218,23)GCCACGATATTATCTTTACAAGCAmplicon SizecDNA: 232 bpgenomic: 8,043
Reverse (449,20)GTCCTCTCCATAGCCCAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-0.416 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGT
TCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGA
AGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTC
TGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)232218 - 449
Exon 5 To Exon 6 (Pair 1)
Forward (317,21)CAGTTCAGAAGAGGAGGAGGAAmplicon SizecDNA: 127 bpgenomic: 4,548
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGA
ATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGG
CTATGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)127317 - 443
Exon 5 To Exon 6 (Pair 2)
Forward (315,21)GACAGTTCAGAAGAGGAGGAGAmplicon SizecDNA: 123 bpgenomic: 4,544
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAA
GAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTG
GGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)123315 - 437
Exon 5 To Exon 6 (Pair 3)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 120 bpgenomic: 4,541
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)120320 - 439
Exon 5 To Exon 6 (Pair 4)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 116 bpgenomic: 4,537
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001198632 (RUNX1T1)5963635 - 6597
NM_001198626 (RUNX1T1)5963861 - 6823
NM_175636 (RUNX1T1)5963553 - 6515
NM_004349 (RUNX1T1)5963654 - 6616
NM_001198679 (RUNX1T1)5963688 - 6650
NM_001198627 (RUNX1T1)5963921 - 6883
NM_001198634 (RUNX1T1)5963544 - 6506
NM_175634 (RUNX1T1)5963779 - 6741
NM_001198630 (RUNX1T1)5963704 - 6666
NM_004967 (IBSP)116322 - 437
NM_175635 (RUNX1T1)5963471 - 6433
NM_001198631 (RUNX1T1)5963717 - 6679
NM_001198625 (RUNX1T1)59631003 - 6965
NM_001198633 (RUNX1T1)5963606 - 6568
NM_001198628 (RUNX1T1)5963518 - 6480
NM_001198629 (RUNX1T1)5963644 - 6606
Exon 5 To Exon 6 (Pair 5)
Forward (284,22)CAGTAGTGACTCATCCGAAGAAAmplicon SizecDNA: 163 bpgenomic: 4,584
Reverse (446,21)CTCTCCATAGCCCAGTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGA
GGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGC
TGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)163284 - 446
Exon 5 To Exon 6 (Pair 6)
Forward (305,23)AAATGGAGATGACAGTTCAGAAGAmplicon SizecDNA: 133 bpgenomic: 4,554
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol in 3' area
Forward Dimers-0.43 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.565 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGA
AAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGC
TACAACACTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)133305 - 437
Exon 5 To Exon 6 (Pair 7)
Forward (282,21)GGCAGTAGTGACTCATCCGAAAmplicon SizecDNA: 156 bpgenomic: 4,577
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAA
GAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAG
GCTGAGAATACCACACTTTCTGCTACAACACTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)156282 - 437
Exon 5 To Exon 6 (Pair 8)
Forward (316,21)ACAGTTCAGAAGAGGAGGAGGAmplicon SizecDNA: 122 bpgenomic: 4,543
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.306 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAG
AATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGG
GC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)122316 - 437
Exon 5 To Exon 6 (Pair 9)
Forward (282,21)GGCAGTAGTGACTCATCCGAAAmplicon SizecDNA: 162 bpgenomic: 4,583
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.753 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAA
GAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAG
GCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)162282 - 443
Exon 5 To Exon 6 (Pair 10)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 125 bpgenomic: 4,546
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCT
ATGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)125319 - 443
Exon 5 To Exon 6 (Pair 11)
Forward (282,21)GGCAGTAGTGACTCATCCGAAAmplicon SizecDNA: 167 bpgenomic: 4,588
Reverse (448,21)TCCTCTCCATAGCCCAGTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.753 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAA
GAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAG
GCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)167282 - 448
Exon 5 To Exon 6 (Pair 12)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 113 bpgenomic: 4,534
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)113319 - 431
Exon 5 To Exon 6 (Pair 13)
Forward (316,21)ACAGTTCAGAAGAGGAGGAGGAmplicon SizecDNA: 116 bpgenomic: 4,537
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.306 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.488 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAG
AATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)116316 - 431
Exon 5 To Exon 6 (Pair 14)
Forward (317,21)CAGTTCAGAAGAGGAGGAGGAAmplicon SizecDNA: 123 bpgenomic: 4,544
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGA
ATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGG
CTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)123317 - 439
Exon 5 To Exon 6 (Pair 15)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 125 bpgenomic: 4,546
Reverse (446,21)CTCTCCATAGCCCAGTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.979 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATG
GAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)125322 - 446
Exon 5 To Exon 6 (Pair 16)
Forward (315,21)GACAGTTCAGAAGAGGAGGAGAmplicon SizecDNA: 125 bpgenomic: 4,546
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAA
GAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTG
GGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)125315 - 439
Exon 5 To Exon 6 (Pair 17)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 114 bpgenomic: 4,535
Reverse (435,22)CCAGTGTTGTAGCAGAAAGTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.875 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.809 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001198632 (RUNX1T1)5963635 - 6597
NM_001198626 (RUNX1T1)5963861 - 6823
NM_175636 (RUNX1T1)5963553 - 6515
NM_004349 (RUNX1T1)5963654 - 6616
NM_001198679 (RUNX1T1)5963688 - 6650
NM_001198627 (RUNX1T1)5963921 - 6883
NM_001198634 (RUNX1T1)5963544 - 6506
NM_175634 (RUNX1T1)5963779 - 6741
NM_001198630 (RUNX1T1)5963704 - 6666
NM_004967 (IBSP)114322 - 435
NM_175635 (RUNX1T1)5963471 - 6433
NM_001198631 (RUNX1T1)5963717 - 6679
NM_001198625 (RUNX1T1)59631003 - 6965
NM_001198633 (RUNX1T1)5963606 - 6568
NM_001198628 (RUNX1T1)5963518 - 6480
NM_001198629 (RUNX1T1)5963644 - 6606
Exon 5 To Exon 6 (Pair 18)
Forward (282,21)GGCAGTAGTGACTCATCCGAAAmplicon SizecDNA: 163 bpgenomic: 4,584
Reverse (444,21)CTCCATAGCCCAGTGTTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops2.315 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.753 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAA
GAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAG
GCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)163282 - 444
Exon 5 To Exon 6 (Pair 19)
Forward (317,21)CAGTTCAGAAGAGGAGGAGGAAmplicon SizecDNA: 115 bpgenomic: 4,536
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.197 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGA
ATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)115317 - 431
Exon 5 To Exon 6 (Pair 20)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 111 bpgenomic: 4,532
Reverse (432,22)GTGTTGTAGCAGAAAGTGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0.468 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001198632 (RUNX1T1)5963635 - 6597
NM_001198626 (RUNX1T1)5963861 - 6823
NM_175636 (RUNX1T1)5963553 - 6515
NM_004349 (RUNX1T1)5963654 - 6616
NM_001198679 (RUNX1T1)5963688 - 6650
NM_001198627 (RUNX1T1)5963921 - 6883
NM_001198634 (RUNX1T1)5963544 - 6506
NM_175634 (RUNX1T1)5963779 - 6741
NM_001198630 (RUNX1T1)5963704 - 6666
NM_004967 (IBSP)111322 - 432
NM_175635 (RUNX1T1)5963471 - 6433
NM_001198631 (RUNX1T1)5963717 - 6679
NM_001198625 (RUNX1T1)59631003 - 6965
NM_001198633 (RUNX1T1)5963606 - 6568
NM_001198628 (RUNX1T1)5963518 - 6480
NM_001198629 (RUNX1T1)5963644 - 6606
Exon 5 To Exon 6 (Pair 21)
Forward (282,21)GGCAGTAGTGACTCATCCGAAAmplicon SizecDNA: 165 bpgenomic: 4,586
Reverse (446,21)CTCTCCATAGCCCAGTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.753 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAA
GAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAG
GCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)165282 - 446
Exon 5 To Exon 6 (Pair 22)
Forward (284,22)CAGTAGTGACTCATCCGAAGAAAmplicon SizecDNA: 154 bpgenomic: 4,575
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGA
GGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGC
TGAGAATACCACACTTTCTGCTACAACACTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)154284 - 437
Exon 5 To Exon 6 (Pair 23)
Forward (282,21)GGCAGTAGTGACTCATCCGAAAmplicon SizecDNA: 150 bpgenomic: 4,571
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.772 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAA
GAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAG
GCTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)150282 - 431
Exon 5 To Exon 6 (Pair 24)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 126 bpgenomic: 4,547
Reverse (444,21)CTCCATAGCCCAGTGTTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops2.315 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.659 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCT
ATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)126319 - 444
Exon 5 To Exon 6 (Pair 25)
Forward (282,21)GGCAGTAGTGACTCATCCGAAAmplicon SizecDNA: 151 bpgenomic: 4,572
Reverse (432,22)GTGTTGTAGCAGAAAGTGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.772 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAA
GAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAG
GCTGAGAATACCACACTTTCTGCTACAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)151282 - 432
Exon 5 To Exon 6 (Pair 26)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 117 bpgenomic: 4,538
Reverse (435,22)CCAGTGTTGTAGCAGAAAGTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.875 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.809 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)117319 - 435
Exon 5 To Exon 6 (Pair 27)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 124 bpgenomic: 4,545
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTA
TGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)124320 - 443
Exon 5 To Exon 6 (Pair 28)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 110 bpgenomic: 4,531
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0.468 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)110322 - 431
Exon 5 To Exon 6 (Pair 29)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 115 bpgenomic: 4,536
Reverse (434,22)CAGTGTTGTAGCAGAAAGTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)115320 - 434
Exon 5 To Exon 6 (Pair 30)
Forward (305,23)AAATGGAGATGACAGTTCAGAAGAmplicon SizecDNA: 135 bpgenomic: 4,556
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol in 3' area
Forward Dimers-0.43 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.565 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGA
AAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGC
TACAACACTGGGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)135305 - 439
Exon 5 To Exon 6 (Pair 31)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 116 bpgenomic: 4,537
Reverse (435,22)CCAGTGTTGTAGCAGAAAGTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.875 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.809 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)116320 - 435
Exon 5 To Exon 6 (Pair 32)
Forward (308,22)TGGAGATGACAGTTCAGAAGAGAmplicon SizecDNA: 132 bpgenomic: 4,553
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.264 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAA
CAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTAC
AACACTGGGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)132308 - 439
Exon 5 To Exon 6 (Pair 33)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 123 bpgenomic: 4,544
Reverse (444,21)CTCCATAGCCCAGTGTTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops2.315 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.659 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATG
GAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)123322 - 444
Exon 5 To Exon 6 (Pair 34)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 112 bpgenomic: 4,533
Reverse (433,22)AGTGTTGTAGCAGAAAGTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0.468 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001198632 (RUNX1T1)5963635 - 6597
NM_001198626 (RUNX1T1)5963861 - 6823
NM_175636 (RUNX1T1)5963553 - 6515
NM_004349 (RUNX1T1)5963654 - 6616
NM_001198679 (RUNX1T1)5963688 - 6650
NM_001198627 (RUNX1T1)5963921 - 6883
NM_001198634 (RUNX1T1)5963544 - 6506
NM_175634 (RUNX1T1)5963779 - 6741
NM_001198630 (RUNX1T1)5963704 - 6666
NM_004967 (IBSP)112322 - 433
NM_175635 (RUNX1T1)5963471 - 6433
NM_001198631 (RUNX1T1)5963717 - 6679
NM_001198625 (RUNX1T1)59631003 - 6965
NM_001198633 (RUNX1T1)5963606 - 6568
NM_001198628 (RUNX1T1)5963518 - 6480
NM_001198629 (RUNX1T1)5963644 - 6606
Exon 5 To Exon 6 (Pair 35)
Forward (317,21)CAGTTCAGAAGAGGAGGAGGAAmplicon SizecDNA: 119 bpgenomic: 4,540
Reverse (435,22)CCAGTGTTGTAGCAGAAAGTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.875 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.809 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGA
ATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)119317 - 435
Exon 5 To Exon 6 (Pair 36)
Forward (316,21)ACAGTTCAGAAGAGGAGGAGGAmplicon SizecDNA: 128 bpgenomic: 4,549
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.306 kcal/mol
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAG
AATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGG
GCTATGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)128316 - 443
Exon 5 To Exon 6 (Pair 37)
Forward (306,23)AATGGAGATGACAGTTCAGAAGAAmplicon SizecDNA: 134 bpgenomic: 4,555
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.565 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAA
AACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCT
ACAACACTGGGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)134306 - 439
Exon 5 To Exon 6 (Pair 38)
Forward (282,21)GGCAGTAGTGACTCATCCGAAAmplicon SizecDNA: 158 bpgenomic: 4,579
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.753 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAA
GAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAG
GCTGAGAATACCACACTTTCTGCTACAACACTGGGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)158282 - 439
Exon 5 To Exon 6 (Pair 39)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 113 bpgenomic: 4,534
Reverse (434,22)CAGTGTTGTAGCAGAAAGTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0.468 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001198632 (RUNX1T1)5963635 - 6597
NM_001198626 (RUNX1T1)5963861 - 6823
NM_175636 (RUNX1T1)5963553 - 6515
NM_004349 (RUNX1T1)5963654 - 6616
NM_001198679 (RUNX1T1)5963688 - 6650
NM_001198627 (RUNX1T1)5963921 - 6883
NM_001198634 (RUNX1T1)5963544 - 6506
NM_175634 (RUNX1T1)5963779 - 6741
NM_001198630 (RUNX1T1)5963704 - 6666
NM_004967 (IBSP)113322 - 434
NM_175635 (RUNX1T1)5963471 - 6433
NM_001198631 (RUNX1T1)5963717 - 6679
NM_001198625 (RUNX1T1)59631003 - 6965
NM_001198633 (RUNX1T1)5963606 - 6568
NM_001198628 (RUNX1T1)5963518 - 6480
NM_001198629 (RUNX1T1)5963644 - 6606
Exon 5 To Exon 6 (Pair 40)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 114 bpgenomic: 4,535
Reverse (433,22)AGTGTTGTAGCAGAAAGTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)114320 - 433
Exon 5 To Exon 6 (Pair 41)
Forward (317,21)CAGTTCAGAAGAGGAGGAGGAAmplicon SizecDNA: 121 bpgenomic: 4,542
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGA
ATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGG
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)121317 - 437
Exon 5 To Exon 6 (Pair 42)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 118 bpgenomic: 4,539
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001198632 (RUNX1T1)5963635 - 6597
NM_001198626 (RUNX1T1)5963861 - 6823
NM_175636 (RUNX1T1)5963553 - 6515
NM_004349 (RUNX1T1)5963654 - 6616
NM_001198679 (RUNX1T1)5963688 - 6650
NM_001198627 (RUNX1T1)5963921 - 6883
NM_001198634 (RUNX1T1)5963544 - 6506
NM_175634 (RUNX1T1)5963779 - 6741
NM_001198630 (RUNX1T1)5963704 - 6666
NM_004967 (IBSP)118320 - 437
NM_175635 (RUNX1T1)5963471 - 6433
NM_001198631 (RUNX1T1)5963717 - 6679
NM_001198625 (RUNX1T1)59631003 - 6965
NM_001198633 (RUNX1T1)5963606 - 6568
NM_001198628 (RUNX1T1)5963518 - 6480
NM_001198629 (RUNX1T1)5963644 - 6606
Exon 5 To Exon 6 (Pair 43)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 118 bpgenomic: 4,539
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001198632 (RUNX1T1)5963635 - 6597
NM_001198626 (RUNX1T1)5963861 - 6823
NM_175636 (RUNX1T1)5963553 - 6515
NM_004349 (RUNX1T1)5963654 - 6616
NM_001198679 (RUNX1T1)5963688 - 6650
NM_001198627 (RUNX1T1)5963921 - 6883
NM_001198634 (RUNX1T1)5963544 - 6506
NM_175634 (RUNX1T1)5963779 - 6741
NM_001198630 (RUNX1T1)5963704 - 6666
NM_004967 (IBSP)118322 - 439
NM_175635 (RUNX1T1)5963471 - 6433
NM_001198631 (RUNX1T1)5963717 - 6679
NM_001198625 (RUNX1T1)59631003 - 6965
NM_001198633 (RUNX1T1)5963606 - 6568
NM_001198628 (RUNX1T1)5963518 - 6480
NM_001198629 (RUNX1T1)5963644 - 6606
Exon 5 To Exon 6 (Pair 44)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 113 bpgenomic: 4,534
Reverse (432,22)GTGTTGTAGCAGAAAGTGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)113320 - 432
Exon 5 To Exon 6 (Pair 45)
Forward (284,22)CAGTAGTGACTCATCCGAAGAAAmplicon SizecDNA: 149 bpgenomic: 4,570
Reverse (432,22)GTGTTGTAGCAGAAAGTGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.772 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGA
GGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGC
TGAGAATACCACACTTTCTGCTACAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)149284 - 432
Exon 5 To Exon 6 (Pair 46)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 119 bpgenomic: 4,540
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)119319 - 437
Exon 5 To Exon 6 (Pair 47)
Forward (283,21)GCAGTAGTGACTCATCCGAAGAmplicon SizecDNA: 164 bpgenomic: 4,585
Reverse (446,21)CTCTCCATAGCCCAGTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAG
AGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGG
CTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)164283 - 446
Exon 5 To Exon 6 (Pair 48)
Forward (316,21)ACAGTTCAGAAGAGGAGGAGGAmplicon SizecDNA: 124 bpgenomic: 4,545
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.306 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAG
AATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGG
GCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)124316 - 439
Exon 5 To Exon 6 (Pair 49)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 128 bpgenomic: 4,549
Reverse (446,21)CTCTCCATAGCCCAGTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.979 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCT
ATGGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)128319 - 446
Exon 5 To Exon 6 (Pair 50)
Forward (306,23)AATGGAGATGACAGTTCAGAAGAAmplicon SizecDNA: 132 bpgenomic: 4,553
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.565 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAA
AACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCT
ACAACACTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)132306 - 437
Exon 5 To Exon 6 (Pair 51)
Forward (283,21)GCAGTAGTGACTCATCCGAAGAmplicon SizecDNA: 162 bpgenomic: 4,583
Reverse (444,21)CTCCATAGCCCAGTGTTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops2.315 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAG
AGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGG
CTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)162283 - 444
Exon 5 To Exon 6 (Pair 52)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 125 bpgenomic: 4,546
Reverse (444,21)CTCCATAGCCCAGTGTTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops2.315 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.659 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTA
TGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)125320 - 444
Exon 5 To Exon 6 (Pair 53)
Forward (283,21)GCAGTAGTGACTCATCCGAAGAmplicon SizecDNA: 150 bpgenomic: 4,571
Reverse (432,22)GTGTTGTAGCAGAAAGTGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.772 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAG
AGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGG
CTGAGAATACCACACTTTCTGCTACAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)150283 - 432
Exon 5 To Exon 6 (Pair 54)
Forward (308,22)TGGAGATGACAGTTCAGAAGAGAmplicon SizecDNA: 130 bpgenomic: 4,551
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.264 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAA
CAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTAC
AACACTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)130308 - 437
Exon 5 To Exon 6 (Pair 55)
Forward (283,21)GCAGTAGTGACTCATCCGAAGAmplicon SizecDNA: 161 bpgenomic: 4,582
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAG
AGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGG
CTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)161283 - 443
Exon 5 To Exon 6 (Pair 56)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 115 bpgenomic: 4,536
Reverse (433,22)AGTGTTGTAGCAGAAAGTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)115319 - 433
Exon 5 To Exon 6 (Pair 57)
Forward (284,22)CAGTAGTGACTCATCCGAAGAAAmplicon SizecDNA: 148 bpgenomic: 4,569
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.772 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGA
GGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGC
TGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)148284 - 431
Exon 5 To Exon 6 (Pair 58)
Forward (317,21)CAGTTCAGAAGAGGAGGAGGAAmplicon SizecDNA: 116 bpgenomic: 4,537
Reverse (432,22)GTGTTGTAGCAGAAAGTGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.197 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGA
ATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)116317 - 432
Exon 5 To Exon 6 (Pair 59)
Forward (282,21)GGCAGTAGTGACTCATCCGAAAmplicon SizecDNA: 168 bpgenomic: 4,589
Reverse (449,20)GTCCTCTCCATAGCCCAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.753 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAA
GAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAG
GCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)168282 - 449
Exon 5 To Exon 6 (Pair 60)
Forward (315,21)GACAGTTCAGAAGAGGAGGAGAmplicon SizecDNA: 129 bpgenomic: 4,550
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAA
GAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTG
GGCTATGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)129315 - 443
Exon 5 To Exon 6 (Pair 61)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 121 bpgenomic: 4,542
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCT
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)121319 - 439
Exon 5 To Exon 6 (Pair 62)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 122 bpgenomic: 4,543
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATG
GA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)122322 - 443
Exon 5 To Exon 6 (Pair 63)
Forward (308,22)TGGAGATGACAGTTCAGAAGAGAmplicon SizecDNA: 136 bpgenomic: 4,557
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.358 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAA
CAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTAC
AACACTGGGCTATGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)136308 - 443
Exon 5 To Exon 6 (Pair 64)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 114 bpgenomic: 4,535
Reverse (432,22)GTGTTGTAGCAGAAAGTGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)114319 - 432
Exon 5 To Exon 6 (Pair 65)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 112 bpgenomic: 4,533
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)112320 - 431
Exon 5 To Exon 6 (Pair 66)
Forward (283,21)GCAGTAGTGACTCATCCGAAGAmplicon SizecDNA: 157 bpgenomic: 4,578
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAG
AGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGG
CTGAGAATACCACACTTTCTGCTACAACACTGGGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)157283 - 439
Exon 5 To Exon 6 (Pair 67)
Forward (283,21)GCAGTAGTGACTCATCCGAAGAmplicon SizecDNA: 149 bpgenomic: 4,570
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.772 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAG
AGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGG
CTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)149283 - 431
Exon 5 To Exon 6 (Pair 68)
Forward (284,22)CAGTAGTGACTCATCCGAAGAAAmplicon SizecDNA: 161 bpgenomic: 4,582
Reverse (444,21)CTCCATAGCCCAGTGTTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops2.315 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGA
GGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGC
TGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)161284 - 444
Exon 5 To Exon 6 (Pair 69)
Forward (283,21)GCAGTAGTGACTCATCCGAAGAmplicon SizecDNA: 155 bpgenomic: 4,576
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAG
AGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGG
CTGAGAATACCACACTTTCTGCTACAACACTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)155283 - 437
Exon 5 To Exon 6 (Pair 70)
Forward (284,22)CAGTAGTGACTCATCCGAAGAAAmplicon SizecDNA: 156 bpgenomic: 4,577
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGA
GGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGC
TGAGAATACCACACTTTCTGCTACAACACTGGGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)156284 - 439
Exon 5 To Exon 6 (Pair 71)
Forward (311,22)AGATGACAGTTCAGAAGAGGAGAmplicon SizecDNA: 133 bpgenomic: 4,554
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.297 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAA
TGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAAC
ACTGGGCTATGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)133311 - 443
Exon 5 To Exon 6 (Pair 72)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 116 bpgenomic: 4,537
Reverse (434,22)CAGTGTTGTAGCAGAAAGTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)116319 - 434
Exon 5 To Exon 6 (Pair 73)
Forward (310,22)GAGATGACAGTTCAGAAGAGGAAmplicon SizecDNA: 134 bpgenomic: 4,555
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.297 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACA
ATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAA
CACTGGGCTATGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)134310 - 443
Exon 5 To Exon 6 (Pair 74)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 127 bpgenomic: 4,548
Reverse (446,21)CTCTCCATAGCCCAGTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.979 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTA
TGGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)127320 - 446
Exon 5 To Exon 6 (Pair 75)
Forward (317,21)CAGTTCAGAAGAGGAGGAGGAAmplicon SizecDNA: 128 bpgenomic: 4,549
Reverse (444,21)CTCCATAGCCCAGTGTTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops2.315 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.659 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGA
ATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGG
CTATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)128317 - 444
Exon 5 To Exon 6 (Pair 76)
Forward (310,22)GAGATGACAGTTCAGAAGAGGAAmplicon SizecDNA: 135 bpgenomic: 4,556
Reverse (444,21)CTCCATAGCCCAGTGTTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops2.315 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.297 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACA
ATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAA
CACTGGGCTATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)135310 - 444
Exon 5 To Exon 6 (Pair 77)
Forward (284,22)CAGTAGTGACTCATCCGAAGAAAmplicon SizecDNA: 160 bpgenomic: 4,581
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGA
GGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGC
TGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)160284 - 443
 

See below for some more details.

Program Output:

Loading ...