Design Results for ibsp

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 4 To Exon 6 (Pair 27)
Forward (220,24)CACGATATTATCTTTACAAGCATGAmplicon SizecDNA: 238 bpgenomic: 8,049
Reverse (457,19)GGCGTGGCGTCCTCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.627 kcal/mol
Reverse Dimers-0.492 kcal/mol
Forward-Reverse Dimers-2.569 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGTTC
AGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAG
AAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTG
AGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGACGCCACGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)238220 - 457
Exon 4 To Exon 6 (Pair 26)
Forward (217,23)GGCCACGATATTATCTTTACAAGAmplicon SizecDNA: 221 bpgenomic: 8,032
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.123 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAG
TTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGG
AAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACT
CTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)221217 - 437
Exon 4 To Exon 6 (Pair 25)
Forward (217,23)GGCCACGATATTATCTTTACAAGAmplicon SizecDNA: 233 bpgenomic: 8,044
Reverse (449,20)GTCCTCTCCATAGCCCAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.45 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAG
TTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGG
AAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACT
CTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)233217 - 449
Exon 4 To Exon 6 (Pair 24)
Forward (219,24)CCACGATATTATCTTTACAAGCATAmplicon SizecDNA: 186 bpgenomic: 7,997
Reverse (404,22)AGCCTCAGAGTCTTCATCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-0.906 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGTT
CAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAA
GAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCT
GAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)186219 - 404
Exon 4 To Exon 6 (Pair 23)
Forward (220,24)CACGATATTATCTTTACAAGCATGAmplicon SizecDNA: 185 bpgenomic: 7,996
Reverse (404,22)AGCCTCAGAGTCTTCATCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-0.906 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGTTC
AGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAG
AAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTG
AGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)185220 - 404
Exon 4 To Exon 6 (Pair 22)
Forward (219,24)CCACGATATTATCTTTACAAGCATAmplicon SizecDNA: 185 bpgenomic: 7,996
Reverse (403,22)GCCTCAGAGTCTTCATCTTCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-0.906 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGTT
CAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAA
GAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCT
GAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)185219 - 403
Exon 4 To Exon 6 (Pair 21)
Forward (217,23)GGCCACGATATTATCTTTACAAGAmplicon SizecDNA: 272 bpgenomic: 8,083
Reverse (488,22)GATTGCAGCTAACCCTGTATACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.569 kcal/mol in 3' area
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-0.647 kcal/mol
Amplicon Folding-1.803 kcal/mol outside primersite
Amplicon SequenceGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAG
TTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGG
AAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACT
CTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGACGCCACGC
CTGGCACAGGGTATACAGGGTTAGCTGCAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)272217 - 488
Exon 4 To Exon 6 (Pair 20)
Forward (218,23)GCCACGATATTATCTTTACAAGCAmplicon SizecDNA: 233 bpgenomic: 8,044
Reverse (450,20)CGTCCTCTCCATAGCCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.195 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGT
TCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGA
AGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTC
TGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)233218 - 450
Exon 4 To Exon 6 (Pair 19)
Forward (220,24)CACGATATTATCTTTACAAGCATGAmplicon SizecDNA: 184 bpgenomic: 7,995
Reverse (403,22)GCCTCAGAGTCTTCATCTTCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-0.906 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGTTC
AGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAG
AAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTG
AGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)184220 - 403
Exon 4 To Exon 6 (Pair 18)
Forward (219,24)CCACGATATTATCTTTACAAGCATAmplicon SizecDNA: 188 bpgenomic: 7,999
Reverse (406,22)TCAGCCTCAGAGTCTTCATCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-0.906 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGTT
CAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAA
GAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCT
GAGGCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)188219 - 406
Exon 4 To Exon 6 (Pair 17)
Forward (218,23)GCCACGATATTATCTTTACAAGCAmplicon SizecDNA: 189 bpgenomic: 8,000
Reverse (406,22)TCAGCCTCAGAGTCTTCATCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-0.906 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGT
TCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGA
AGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTC
TGAGGCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)189218 - 406
Exon 4 To Exon 6 (Pair 16)
Forward (218,23)GCCACGATATTATCTTTACAAGCAmplicon SizecDNA: 232 bpgenomic: 8,043
Reverse (449,20)GTCCTCTCCATAGCCCAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-0.416 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGT
TCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGA
AGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTC
TGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)232218 - 449
Exon 4 To Exon 6 (Pair 15)
Forward (220,24)CACGATATTATCTTTACAAGCATGAmplicon SizecDNA: 187 bpgenomic: 7,998
Reverse (406,22)TCAGCCTCAGAGTCTTCATCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-0.906 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGTTC
AGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAG
AAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTG
AGGCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)187220 - 406
Exon 4 To Exon 6 (Pair 14)
Forward (217,23)GGCCACGATATTATCTTTACAAGAmplicon SizecDNA: 273 bpgenomic: 8,084
Reverse (489,22)GGATTGCAGCTAACCCTGTATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.569 kcal/mol in 3' area
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding-1.803 kcal/mol outside primersite
Amplicon SequenceGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAG
TTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGG
AAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACT
CTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGACGCCACGC
CTGGCACAGGGTATACAGGGTTAGCTGCAATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)273217 - 489
Exon 4 To Exon 6 (Pair 13)
Forward (217,23)GGCCACGATATTATCTTTACAAGAmplicon SizecDNA: 232 bpgenomic: 8,043
Reverse (448,21)TCCTCTCCATAGCCCAGTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.45 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAG
TTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGG
AAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACT
CTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)232217 - 448
Exon 4 To Exon 6 (Pair 12)
Forward (217,23)GGCCACGATATTATCTTTACAAGAmplicon SizecDNA: 190 bpgenomic: 8,001
Reverse (406,22)TCAGCCTCAGAGTCTTCATCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-1.482 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAG
TTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGG
AAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACT
CTGAGGCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)190217 - 406
Exon 4 To Exon 6 (Pair 11)
Forward (217,23)GGCCACGATATTATCTTTACAAGAmplicon SizecDNA: 230 bpgenomic: 8,041
Reverse (446,21)CTCTCCATAGCCCAGTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.45 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAG
TTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGG
AAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACT
CTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)230217 - 446
Exon 4 To Exon 6 (Pair 10)
Forward (217,23)GGCCACGATATTATCTTTACAAGAmplicon SizecDNA: 227 bpgenomic: 8,038
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.45 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAG
TTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGG
AAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACT
CTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)227217 - 443
Exon 4 To Exon 6 (Pair 9)
Forward (218,23)GCCACGATATTATCTTTACAAGCAmplicon SizecDNA: 187 bpgenomic: 7,998
Reverse (404,22)AGCCTCAGAGTCTTCATCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-0.906 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGT
TCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGA
AGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTC
TGAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)187218 - 404
Exon 4 To Exon 6 (Pair 8)
Forward (217,23)GGCCACGATATTATCTTTACAAGAmplicon SizecDNA: 228 bpgenomic: 8,039
Reverse (444,21)CTCCATAGCCCAGTGTTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops2.315 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.45 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAG
TTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGG
AAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACT
CTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)228217 - 444
Exon 4 To Exon 6 (Pair 7)
Forward (220,24)CACGATATTATCTTTACAAGCATGAmplicon SizecDNA: 239 bpgenomic: 8,050
Reverse (458,19)AGGCGTGGCGTCCTCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.4 kcal/mol
Reverse Dimers-0.678 kcal/mol
Forward-Reverse Dimers-2.569 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGTTC
AGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAG
AAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTG
AGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGACGCCACGCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)239220 - 458
Exon 4 To Exon 6 (Pair 6)
Forward (217,23)GGCCACGATATTATCTTTACAAGAmplicon SizecDNA: 187 bpgenomic: 7,998
Reverse (403,22)GCCTCAGAGTCTTCATCTTCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-1.155 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAG
TTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGG
AAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACT
CTGAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)187217 - 403
Exon 4 To Exon 6 (Pair 5)
Forward (218,23)GCCACGATATTATCTTTACAAGCAmplicon SizecDNA: 186 bpgenomic: 7,997
Reverse (403,22)GCCTCAGAGTCTTCATCTTCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-0.906 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGT
TCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGA
AGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTC
TGAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)186218 - 403
Exon 4 To Exon 6 (Pair 4)
Forward (219,24)CCACGATATTATCTTTACAAGCATAmplicon SizecDNA: 232 bpgenomic: 8,043
Reverse (450,20)CGTCCTCTCCATAGCCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.195 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGTT
CAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAA
GAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCT
GAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)232219 - 450
Exon 4 To Exon 6 (Pair 3)
Forward (217,23)GGCCACGATATTATCTTTACAAGAmplicon SizecDNA: 223 bpgenomic: 8,034
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.45 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAG
TTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGG
AAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACT
CTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)223217 - 439
Exon 4 To Exon 6 (Pair 2)
Forward (217,23)GGCCACGATATTATCTTTACAAGAmplicon SizecDNA: 275 bpgenomic: 8,086
Reverse (491,21)CTGGATTGCAGCTAACCCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.015 kcal/mol
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-1.453 kcal/mol
Amplicon Folding-1.803 kcal/mol outside primersite
Amplicon SequenceGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAG
TTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGG
AAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACT
CTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGACGCCACGC
CTGGCACAGGGTATACAGGGTTAGCTGCAATCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)275217 - 491
Exon 4 To Exon 6 (Pair 1)
Forward (217,23)GGCCACGATATTATCTTTACAAGAmplicon SizecDNA: 234 bpgenomic: 8,045
Reverse (450,20)CGTCCTCTCCATAGCCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.195 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAG
TTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGG
AAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACT
CTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)234217 - 450
Exon 4 To Exon 6 (Pair 28)
Forward (217,23)GGCCACGATATTATCTTTACAAGAmplicon SizecDNA: 274 bpgenomic: 8,085
Reverse (490,22)TGGATTGCAGCTAACCCTGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.569 kcal/mol in 3' area
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-1.453 kcal/mol
Amplicon Folding-1.803 kcal/mol outside primersite
Amplicon SequenceGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAG
TTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGG
AAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACT
CTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGACGCCACGC
CTGGCACAGGGTATACAGGGTTAGCTGCAATCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)274217 - 490
Exon 4 To Exon 6 (Pair 29)
Forward (217,23)GGCCACGATATTATCTTTACAAGAmplicon SizecDNA: 188 bpgenomic: 7,999
Reverse (404,22)AGCCTCAGAGTCTTCATCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-1.482 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAG
TTCAGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGG
AAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACT
CTGAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)188217 - 404
Exon 4 To Exon 6 (Pair 30)
Forward (220,24)CACGATATTATCTTTACAAGCATGAmplicon SizecDNA: 231 bpgenomic: 8,042
Reverse (450,20)CGTCCTCTCCATAGCCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.786 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.195 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCACGATATTATCTTTACAAGCATGCCTACTTTTATCCTCATTTAAAACGATTTCCAGTTC
AGGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAG
AAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTG
AGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)231220 - 450
Exon 5 To Exon 6 (Pair 160)
Forward (310,22)GAGATGACAGTTCAGAAGAGGAAmplicon SizecDNA: 122 bpgenomic: 4,543
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.051 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACA
ATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAA
CA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)122310 - 431
Exon 5 To Exon 6 (Pair 159)
Forward (284,22)CAGTAGTGACTCATCCGAAGAAAmplicon SizecDNA: 156 bpgenomic: 4,577
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGA
GGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGC
TGAGAATACCACACTTTCTGCTACAACACTGGGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)156284 - 439
Exon 5 To Exon 6 (Pair 157)
Forward (306,23)AATGGAGATGACAGTTCAGAAGAAmplicon SizecDNA: 126 bpgenomic: 4,547
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.051 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAA
AACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCT
ACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)126306 - 431
Exon 5 To Exon 6 (Pair 158)
Forward (284,22)CAGTAGTGACTCATCCGAAGAAAmplicon SizecDNA: 161 bpgenomic: 4,582
Reverse (444,21)CTCCATAGCCCAGTGTTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops2.315 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGA
GGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGC
TGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)161284 - 444
Exon 5 To Exon 6 (Pair 156)
Forward (283,21)GCAGTAGTGACTCATCCGAAGAmplicon SizecDNA: 149 bpgenomic: 4,570
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.772 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAG
AGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGG
CTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)149283 - 431
Exon 5 To Exon 6 (Pair 154)
Forward (283,21)GCAGTAGTGACTCATCCGAAGAmplicon SizecDNA: 122 bpgenomic: 4,543
Reverse (404,22)AGCCTCAGAGTCTTCATCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.219 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAG
AGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGG
CT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)122283 - 404
Exon 5 To Exon 6 (Pair 155)
Forward (315,21)GACAGTTCAGAAGAGGAGGAGAmplicon SizecDNA: 92 bpgenomic: 4,513
Reverse (406,22)TCAGCCTCAGAGTCTTCATCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAA
GAATCGAATGAAGATGAAGACTCTGAGGCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)92315 - 406
Exon 5 To Exon 6 (Pair 153)
Forward (282,21)GGCAGTAGTGACTCATCCGAAAmplicon SizecDNA: 168 bpgenomic: 4,589
Reverse (449,20)GTCCTCTCCATAGCCCAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.753 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAA
GAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAG
GCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)168282 - 449
Exon 5 To Exon 6 (Pair 152)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 115 bpgenomic: 4,536
Reverse (433,22)AGTGTTGTAGCAGAAAGTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)115319 - 433
Exon 5 To Exon 6 (Pair 151)
Forward (316,21)ACAGTTCAGAAGAGGAGGAGGAmplicon SizecDNA: 124 bpgenomic: 4,545
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.306 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAG
AATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGG
GCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)124316 - 439
Exon 5 To Exon 6 (Pair 150)
Forward (305,23)AAATGGAGATGACAGTTCAGAAGAmplicon SizecDNA: 127 bpgenomic: 4,548
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol in 3' area
Forward Dimers-0.43 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.051 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGA
AAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGC
TACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)127305 - 431
Exon 5 To Exon 6 (Pair 147)
Forward (306,23)AATGGAGATGACAGTTCAGAAGAAmplicon SizecDNA: 134 bpgenomic: 4,555
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.565 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAA
AACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCT
ACAACACTGGGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)134306 - 439
Exon 5 To Exon 6 (Pair 148)
Forward (282,21)GGCAGTAGTGACTCATCCGAAAmplicon SizecDNA: 125 bpgenomic: 4,546
Reverse (406,22)TCAGCCTCAGAGTCTTCATCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.219 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAA
GAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAG
GCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)125282 - 406
Exon 5 To Exon 6 (Pair 149)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 170 bpgenomic: 4,591
Reverse (489,22)GGATTGCAGCTAACCCTGTATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.569 kcal/mol in 3' area
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.803 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTA
TGGAGAGGACGCCACGCCTGGCACAGGGTATACAGGGTTAGCTGCAATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)170320 - 489
Exon 5 To Exon 6 (Pair 146)
Forward (305,23)AAATGGAGATGACAGTTCAGAAGAmplicon SizecDNA: 186 bpgenomic: 4,607
Reverse (490,22)TGGATTGCAGCTAACCCTGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol in 3' area
Forward Dimers-0.43 kcal/mol
Reverse Loops1.569 kcal/mol in 3' area
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-1.929 kcal/mol
Amplicon Folding-1.803 kcal/mol outside primersite
Amplicon SequenceAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGA
AAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGC
TACAACACTGGGCTATGGAGAGGACGCCACGCCTGGCACAGGGTATACAGGGTTAGCTGC
AATCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)186305 - 490
Exon 5 To Exon 6 (Pair 145)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 112 bpgenomic: 4,533
Reverse (433,22)AGTGTTGTAGCAGAAAGTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0.468 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001198632 (RUNX1T1)5963635 - 6597
NM_004349 (RUNX1T1)5963654 - 6616
NM_001198679 (RUNX1T1)5963688 - 6650
NM_001198634 (RUNX1T1)5963544 - 6506
NM_175634 (RUNX1T1)5963779 - 6741
NM_001198630 (RUNX1T1)5963704 - 6666
NM_004967 (IBSP)112322 - 433
NM_175635 (RUNX1T1)5963471 - 6433
NM_001198625 (RUNX1T1)59631003 - 6965
NM_001198633 (RUNX1T1)5963606 - 6568
NM_001198628 (RUNX1T1)5963518 - 6480
NM_001198629 (RUNX1T1)5963644 - 6606
Exon 5 To Exon 6 (Pair 144)
Forward (308,22)TGGAGATGACAGTTCAGAAGAGAmplicon SizecDNA: 183 bpgenomic: 4,604
Reverse (490,22)TGGATTGCAGCTAACCCTGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.569 kcal/mol in 3' area
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-1.929 kcal/mol
Amplicon Folding-1.803 kcal/mol outside primersite
Amplicon SequenceTGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAA
CAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTAC
AACACTGGGCTATGGAGAGGACGCCACGCCTGGCACAGGGTATACAGGGTTAGCTGCAAT
CCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)183308 - 490
Exon 5 To Exon 6 (Pair 143)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 116 bpgenomic: 4,537
Reverse (435,22)CCAGTGTTGTAGCAGAAAGTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.875 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.809 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)116320 - 435
Exon 5 To Exon 6 (Pair 142)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 123 bpgenomic: 4,544
Reverse (444,21)CTCCATAGCCCAGTGTTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops2.315 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.659 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATG
GAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)123322 - 444
Exon 5 To Exon 6 (Pair 141)
Forward (305,23)AAATGGAGATGACAGTTCAGAAGAmplicon SizecDNA: 135 bpgenomic: 4,556
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol in 3' area
Forward Dimers-0.43 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.565 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGA
AAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGC
TACAACACTGGGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)135305 - 439
Exon 5 To Exon 6 (Pair 140)
Forward (316,21)ACAGTTCAGAAGAGGAGGAGGAmplicon SizecDNA: 88 bpgenomic: 4,509
Reverse (403,22)GCCTCAGAGTCTTCATCTTCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.306 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAG
AATCGAATGAAGATGAAGACTCTGAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)88316 - 403
Exon 5 To Exon 6 (Pair 139)
Forward (282,21)GGCAGTAGTGACTCATCCGAAAmplicon SizecDNA: 151 bpgenomic: 4,572
Reverse (432,22)GTGTTGTAGCAGAAAGTGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.772 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAA
GAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAG
GCTGAGAATACCACACTTTCTGCTACAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)151282 - 432
Exon 5 To Exon 6 (Pair 137)
Forward (317,21)CAGTTCAGAAGAGGAGGAGGAAmplicon SizecDNA: 90 bpgenomic: 4,511
Reverse (406,22)TCAGCCTCAGAGTCTTCATCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGA
ATCGAATGAAGATGAAGACTCTGAGGCTGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_020733 (HEG1)-4842075 - 1590
NM_004967 (IBSP)90317 - 406
Exon 5 To Exon 6 (Pair 138)
Forward (308,22)TGGAGATGACAGTTCAGAAGAGAmplicon SizecDNA: 93 bpgenomic: 4,514
Reverse (400,23)TCAGAGTCTTCATCTTCATTCGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.953 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAA
CAATGAAGAATCGAATGAAGATGAAGACTCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)93308 - 400
Exon 5 To Exon 6 (Pair 136)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 83 bpgenomic: 4,504
Reverse (404,22)AGCCTCAGAGTCTTCATCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)83322 - 404
Exon 5 To Exon 6 (Pair 135)
Forward (310,22)GAGATGACAGTTCAGAAGAGGAAmplicon SizecDNA: 91 bpgenomic: 4,512
Reverse (400,23)TCAGAGTCTTCATCTTCATTCGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.953 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACA
ATGAAGAATCGAATGAAGATGAAGACTCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)91310 - 400
Exon 5 To Exon 6 (Pair 133)
Forward (306,23)AATGGAGATGACAGTTCAGAAGAAmplicon SizecDNA: 186 bpgenomic: 4,607
Reverse (491,21)CTGGATTGCAGCTAACCCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.015 kcal/mol
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-1.929 kcal/mol
Amplicon Folding-1.803 kcal/mol outside primersite
Amplicon SequenceAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAA
AACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCT
ACAACACTGGGCTATGGAGAGGACGCCACGCCTGGCACAGGGTATACAGGGTTAGCTGCA
ATCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)186306 - 491
Exon 5 To Exon 6 (Pair 134)
Forward (283,21)GCAGTAGTGACTCATCCGAAGAmplicon SizecDNA: 118 bpgenomic: 4,539
Reverse (400,23)TCAGAGTCTTCATCTTCATTCGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.219 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAG
AGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)118283 - 400
Exon 5 To Exon 6 (Pair 132)
Forward (282,21)GGCAGTAGTGACTCATCCGAAAmplicon SizecDNA: 118 bpgenomic: 4,539
Reverse (399,23)CAGAGTCTTCATCTTCATTCGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.219 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAA
GAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)118282 - 399
Exon 5 To Exon 6 (Pair 131)
Forward (313,22)ATGACAGTTCAGAAGAGGAGGAAmplicon SizecDNA: 119 bpgenomic: 4,540
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.051 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATG
AAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)119313 - 431
Exon 5 To Exon 6 (Pair 130)
Forward (305,23)AAATGGAGATGACAGTTCAGAAGAmplicon SizecDNA: 133 bpgenomic: 4,554
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol in 3' area
Forward Dimers-0.43 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.565 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGA
AAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGC
TACAACACTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)133305 - 437
Exon 5 To Exon 6 (Pair 129)
Forward (305,23)AAATGGAGATGACAGTTCAGAAGAmplicon SizecDNA: 139 bpgenomic: 4,560
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol in 3' area
Forward Dimers-0.43 kcal/mol
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.709 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGA
AAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGC
TACAACACTGGGCTATGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)139305 - 443
Exon 5 To Exon 6 (Pair 128)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 116 bpgenomic: 4,537
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001198632 (RUNX1T1)5963635 - 6597
NM_001198626 (RUNX1T1)5963861 - 6823
NM_175636 (RUNX1T1)5963553 - 6515
NM_004349 (RUNX1T1)5963654 - 6616
NM_001198679 (RUNX1T1)5963688 - 6650
NM_001198627 (RUNX1T1)5963921 - 6883
NM_001198634 (RUNX1T1)5963544 - 6506
NM_175634 (RUNX1T1)5963779 - 6741
NM_001198630 (RUNX1T1)5963704 - 6666
NM_004967 (IBSP)116322 - 437
NM_175635 (RUNX1T1)5963471 - 6433
NM_001198631 (RUNX1T1)5963717 - 6679
NM_001198625 (RUNX1T1)59631003 - 6965
NM_001198633 (RUNX1T1)5963606 - 6568
NM_001198628 (RUNX1T1)5963518 - 6480
NM_001198629 (RUNX1T1)5963644 - 6606
Exon 5 To Exon 6 (Pair 127)
Forward (310,22)GAGATGACAGTTCAGAAGAGGAAmplicon SizecDNA: 135 bpgenomic: 4,556
Reverse (444,21)CTCCATAGCCCAGTGTTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops2.315 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.297 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACA
ATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAA
CACTGGGCTATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)135310 - 444
Exon 5 To Exon 6 (Pair 126)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 85 bpgenomic: 4,506
Reverse (406,22)TCAGCCTCAGAGTCTTCATCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_020733 (HEG1)-4842075 - 1590
NM_004967 (IBSP)85322 - 406
Exon 5 To Exon 6 (Pair 125)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 82 bpgenomic: 4,503
Reverse (400,23)TCAGAGTCTTCATCTTCATTCGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.327 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)82319 - 400
Exon 5 To Exon 6 (Pair 124)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 112 bpgenomic: 4,533
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)112320 - 431
Exon 5 To Exon 6 (Pair 123)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 114 bpgenomic: 4,535
Reverse (432,22)GTGTTGTAGCAGAAAGTGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)114319 - 432
Exon 5 To Exon 6 (Pair 122)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 121 bpgenomic: 4,542
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCT
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)121319 - 439
Exon 5 To Exon 6 (Pair 121)
Forward (306,23)AATGGAGATGACAGTTCAGAAGAAmplicon SizecDNA: 184 bpgenomic: 4,605
Reverse (489,22)GGATTGCAGCTAACCCTGTATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.569 kcal/mol in 3' area
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-1.929 kcal/mol
Amplicon Folding-1.803 kcal/mol outside primersite
Amplicon SequenceAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAA
AACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCT
ACAACACTGGGCTATGGAGAGGACGCCACGCCTGGCACAGGGTATACAGGGTTAGCTGCA
ATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)184306 - 489
Exon 5 To Exon 6 (Pair 119)
Forward (308,22)TGGAGATGACAGTTCAGAAGAGAmplicon SizecDNA: 130 bpgenomic: 4,551
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.264 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAA
CAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTAC
AACACTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)130308 - 437
Exon 5 To Exon 6 (Pair 120)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 171 bpgenomic: 4,592
Reverse (489,22)GGATTGCAGCTAACCCTGTATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.569 kcal/mol in 3' area
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.803 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCT
ATGGAGAGGACGCCACGCCTGGCACAGGGTATACAGGGTTAGCTGCAATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)171319 - 489
Exon 5 To Exon 6 (Pair 118)
Forward (306,23)AATGGAGATGACAGTTCAGAAGAAmplicon SizecDNA: 138 bpgenomic: 4,559
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.709 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAA
AACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCT
ACAACACTGGGCTATGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)138306 - 443
Exon 5 To Exon 6 (Pair 116)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 125 bpgenomic: 4,546
Reverse (444,21)CTCCATAGCCCAGTGTTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops2.315 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.659 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTA
TGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)125320 - 444
Exon 5 To Exon 6 (Pair 117)
Forward (283,21)GCAGTAGTGACTCATCCGAAGAmplicon SizecDNA: 150 bpgenomic: 4,571
Reverse (432,22)GTGTTGTAGCAGAAAGTGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.772 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAG
AGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGG
CTGAGAATACCACACTTTCTGCTACAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)150283 - 432
Exon 5 To Exon 6 (Pair 115)
Forward (283,21)GCAGTAGTGACTCATCCGAAGAmplicon SizecDNA: 162 bpgenomic: 4,583
Reverse (444,21)CTCCATAGCCCAGTGTTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops2.315 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAG
AGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGG
CTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)162283 - 444
Exon 5 To Exon 6 (Pair 114)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 128 bpgenomic: 4,549
Reverse (446,21)CTCTCCATAGCCCAGTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.979 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCT
ATGGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)128319 - 446
Exon 5 To Exon 6 (Pair 113)
Forward (317,21)CAGTTCAGAAGAGGAGGAGGAAmplicon SizecDNA: 173 bpgenomic: 4,594
Reverse (489,22)GGATTGCAGCTAACCCTGTATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.569 kcal/mol in 3' area
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.803 kcal/mol outside primersite
Amplicon SequenceCAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGA
ATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGG
CTATGGAGAGGACGCCACGCCTGGCACAGGGTATACAGGGTTAGCTGCAATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)173317 - 489
Exon 5 To Exon 6 (Pair 112)
Forward (284,22)CAGTAGTGACTCATCCGAAGAAAmplicon SizecDNA: 207 bpgenomic: 4,628
Reverse (490,22)TGGATTGCAGCTAACCCTGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.569 kcal/mol in 3' area
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-1.896 kcal/mol
Amplicon Folding-1.803 kcal/mol outside primersite
Amplicon SequenceCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGA
GGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGC
TGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAGGACGCCACGCCTGGCAC
AGGGTATACAGGGTTAGCTGCAATCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)207284 - 490
Exon 5 To Exon 6 (Pair 111)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 85 bpgenomic: 4,506
Reverse (404,22)AGCCTCAGAGTCTTCATCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)85320 - 404
Exon 5 To Exon 6 (Pair 110)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 85 bpgenomic: 4,506
Reverse (403,22)GCCTCAGAGTCTTCATCTTCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)85319 - 403
Exon 5 To Exon 6 (Pair 109)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 113 bpgenomic: 4,534
Reverse (434,22)CAGTGTTGTAGCAGAAAGTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers0.468 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001198632 (RUNX1T1)5963635 - 6597
NM_001198626 (RUNX1T1)5963861 - 6823
NM_175636 (RUNX1T1)5963553 - 6515
NM_004349 (RUNX1T1)5963654 - 6616
NM_001198679 (RUNX1T1)5963688 - 6650
NM_001198627 (RUNX1T1)5963921 - 6883
NM_001198634 (RUNX1T1)5963544 - 6506
NM_175634 (RUNX1T1)5963779 - 6741
NM_001198630 (RUNX1T1)5963704 - 6666
NM_004967 (IBSP)113322 - 434
NM_175635 (RUNX1T1)5963471 - 6433
NM_001198631 (RUNX1T1)5963717 - 6679
NM_001198625 (RUNX1T1)59631003 - 6965
NM_001198633 (RUNX1T1)5963606 - 6568
NM_001198628 (RUNX1T1)5963518 - 6480
NM_001198629 (RUNX1T1)5963644 - 6606
Exon 5 To Exon 6 (Pair 108)
Forward (305,23)AAATGGAGATGACAGTTCAGAAGAmplicon SizecDNA: 187 bpgenomic: 4,608
Reverse (491,21)CTGGATTGCAGCTAACCCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol in 3' area
Forward Dimers-0.43 kcal/mol
Reverse Loops1.015 kcal/mol
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-1.929 kcal/mol
Amplicon Folding-1.803 kcal/mol outside primersite
Amplicon SequenceAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGA
AAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGC
TACAACACTGGGCTATGGAGAGGACGCCACGCCTGGCACAGGGTATACAGGGTTAGCTGC
AATCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)187305 - 491
Exon 5 To Exon 6 (Pair 107)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 115 bpgenomic: 4,536
Reverse (434,22)CAGTGTTGTAGCAGAAAGTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.697 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.027 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)115320 - 434
Exon 5 To Exon 6 (Pair 106)
Forward (308,22)TGGAGATGACAGTTCAGAAGAGAmplicon SizecDNA: 141 bpgenomic: 4,562
Reverse (448,21)TCCTCTCCATAGCCCAGTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.857 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAA
CAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTAC
AACACTGGGCTATGGAGAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)141308 - 448
Exon 5 To Exon 6 (Pair 105)
Forward (315,21)GACAGTTCAGAAGAGGAGGAGAmplicon SizecDNA: 89 bpgenomic: 4,510
Reverse (403,22)GCCTCAGAGTCTTCATCTTCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAA
GAATCGAATGAAGATGAAGACTCTGAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)89315 - 403
Exon 5 To Exon 6 (Pair 104)
Forward (305,23)AAATGGAGATGACAGTTCAGAAGAmplicon SizecDNA: 184 bpgenomic: 4,605
Reverse (488,22)GATTGCAGCTAACCCTGTATACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol in 3' area
Forward Dimers-0.43 kcal/mol
Reverse Loops1.569 kcal/mol in 3' area
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-1.929 kcal/mol
Amplicon Folding-1.803 kcal/mol outside primersite
Amplicon SequenceAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGA
AAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGC
TACAACACTGGGCTATGGAGAGGACGCCACGCCTGGCACAGGGTATACAGGGTTAGCTGC
AATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)184305 - 488
Exon 5 To Exon 6 (Pair 103)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 124 bpgenomic: 4,545
Reverse (443,21)TCCATAGCCCAGTGTTGTAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops2.082 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTA
TGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)124320 - 443
Exon 5 To Exon 6 (Pair 102)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 117 bpgenomic: 4,538
Reverse (435,22)CCAGTGTTGTAGCAGAAAGTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.875 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.809 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)117319 - 435
Exon 5 To Exon 6 (Pair 101)
Forward (308,22)TGGAGATGACAGTTCAGAAGAGAmplicon SizecDNA: 124 bpgenomic: 4,545
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.051 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAA
CAATGAAGAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTAC
AACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)124308 - 431
Exon 5 To Exon 6 (Pair 100)
Forward (284,22)CAGTAGTGACTCATCCGAAGAAAmplicon SizecDNA: 154 bpgenomic: 4,575
Reverse (437,21)GCCCAGTGTTGTAGCAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.987 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAGA
GGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGGC
TGAGAATACCACACTTTCTGCTACAACACTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)154284 - 437
Exon 5 To Exon 6 (Pair 99)
Forward (282,21)GGCAGTAGTGACTCATCCGAAAmplicon SizecDNA: 165 bpgenomic: 4,586
Reverse (446,21)CTCTCCATAGCCCAGTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops2.153 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.753 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAA
GAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAG
GCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATGGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)165282 - 446
Exon 5 To Exon 6 (Pair 97)
Forward (316,21)ACAGTTCAGAAGAGGAGGAGGAmplicon SizecDNA: 89 bpgenomic: 4,510
Reverse (404,22)AGCCTCAGAGTCTTCATCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.306 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAG
AATCGAATGAAGATGAAGACTCTGAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)89316 - 404
Exon 5 To Exon 6 (Pair 98)
Forward (317,21)CAGTTCAGAAGAGGAGGAGGAAmplicon SizecDNA: 115 bpgenomic: 4,536
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.197 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGA
ATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)115317 - 431
Exon 5 To Exon 6 (Pair 96)
Forward (320,22)TTCAGAAGAGGAGGAGGAAGAAAmplicon SizecDNA: 84 bpgenomic: 4,505
Reverse (403,22)GCCTCAGAGTCTTCATCTTCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol in 3' area
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATC
GAATGAAGATGAAGACTCTGAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)84320 - 403
Exon 5 To Exon 6 (Pair 95)
Forward (322,21)CAGAAGAGGAGGAGGAAGAAGAmplicon SizecDNA: 168 bpgenomic: 4,589
Reverse (489,22)GGATTGCAGCTAACCCTGTATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers1001.74 kcal/mol
Reverse Loops1.569 kcal/mol in 3' area
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.803 kcal/mol outside primersite
Amplicon SequenceCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGA
ATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGGCTATG
GAGAGGACGCCACGCCTGGCACAGGGTATACAGGGTTAGCTGCAATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)168322 - 489
Exon 5 To Exon 6 (Pair 94)
Forward (283,21)GCAGTAGTGACTCATCCGAAGAmplicon SizecDNA: 121 bpgenomic: 4,542
Reverse (403,22)GCCTCAGAGTCTTCATCTTCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.674 kcal/mol
Forward Dimers-1.598 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.219 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGCAGTAGTGACTCATCCGAAGAAAATGGAGATGACAGTTCAGAAGAGGAGGAGGAAGAAG
AGGAGACTTCAAATGAAGGAGAAAACAATGAAGAATCGAATGAAGATGAAGACTCTGAGG
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)121283 - 403
Exon 5 To Exon 6 (Pair 93)
Forward (317,21)CAGTTCAGAAGAGGAGGAGGAAmplicon SizecDNA: 123 bpgenomic: 4,544
Reverse (439,22)TAGCCCAGTGTTGTAGCAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.66 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceCAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGA
ATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACACTGGG
CTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)123317 - 439
Exon 5 To Exon 6 (Pair 91)
Forward (315,21)GACAGTTCAGAAGAGGAGGAGAmplicon SizecDNA: 117 bpgenomic: 4,538
Reverse (431,23)TGTTGTAGCAGAAAGTGTGGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers-0.43 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.051 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGACAGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAA
GAATCGAATGAAGATGAAGACTCTGAGGCTGAGAATACCACACTTTCTGCTACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)117315 - 431
Exon 5 To Exon 6 (Pair 92)
Forward (319,21)GTTCAGAAGAGGAGGAGGAAGAmplicon SizecDNA: 86 bpgenomic: 4,507
Reverse (404,22)AGCCTCAGAGTCTTCATCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol
Forward Dimers0.502 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.049 kcal/mol outside primersite
Amplicon SequenceGTTCAGAAGAGGAGGAGGAAGAAGAGGAGACTTCAAATGAAGGAGAAAACAATGAAGAAT
CGAATGAAGATGAAGACTCTGAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004967 (IBSP)86319 - 404
 

See below for some more details.

Program Output:

Loading ...