Design Results for itga9

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 15 To Exon 16 (Pair 1)
Forward (1666,20)CCATGGGTCAGGTCACAGAGAmplicon SizecDNA: 160 bpgenomic: 86,761
Reverse (1825,20)CTCTCCTCCTCTCCAGTCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.324 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops2.589 kcal/mol in 3' area
Reverse Dimers0.25 kcal/mol in 3' area
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.993 kcal/mol outside primersite
Amplicon SequenceCCATGGGTCAGGTCACAGAGAAGCTGCAGCTGACTTACATGGAGGAGACGTGTCGTCACT
ATGTGGCCCATGTGAAGCGGAGGGTGCAGGACGTCATCAGCCCGATCGTGTTTGAAGCAG
CCTACAGCCTCAGTGAGCATGTGACTGGAGAGGAGGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1601666 - 1825
Exon 15 To Exon 16 (Pair 2)
Forward (1666,20)CCATGGGTCAGGTCACAGAGAmplicon SizecDNA: 165 bpgenomic: 86,766
Reverse (1830,20)GTTCCCTCTCCTCCTCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.324 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops999.577 kcal/mol
Reverse Dimers1.896 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.993 kcal/mol outside primersite
Amplicon SequenceCCATGGGTCAGGTCACAGAGAAGCTGCAGCTGACTTACATGGAGGAGACGTGTCGTCACT
ATGTGGCCCATGTGAAGCGGAGGGTGCAGGACGTCATCAGCCCGATCGTGTTTGAAGCAG
CCTACAGCCTCAGTGAGCATGTGACTGGAGAGGAGGAGAGGGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1651666 - 1830
Exon 15 To Exon 16 (Pair 3)
Forward (1666,20)CCATGGGTCAGGTCACAGAGAmplicon SizecDNA: 163 bpgenomic: 86,764
Reverse (1828,20)TCCCTCTCCTCCTCTCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.324 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops2.589 kcal/mol in 3' area
Reverse Dimers0.371 kcal/mol in 3' area
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.993 kcal/mol outside primersite
Amplicon SequenceCCATGGGTCAGGTCACAGAGAAGCTGCAGCTGACTTACATGGAGGAGACGTGTCGTCACT
ATGTGGCCCATGTGAAGCGGAGGGTGCAGGACGTCATCAGCCCGATCGTGTTTGAAGCAG
CCTACAGCCTCAGTGAGCATGTGACTGGAGAGGAGGAGAGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1631666 - 1828
Exon 15 To Exon 16 (Pair 4)
Forward (1666,20)CCATGGGTCAGGTCACAGAGAmplicon SizecDNA: 168 bpgenomic: 86,769
Reverse (1833,20)GCAGTTCCCTCTCCTCCTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.324 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops1.455 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.993 kcal/mol outside primersite
Amplicon SequenceCCATGGGTCAGGTCACAGAGAAGCTGCAGCTGACTTACATGGAGGAGACGTGTCGTCACT
ATGTGGCCCATGTGAAGCGGAGGGTGCAGGACGTCATCAGCCCGATCGTGTTTGAAGCAG
CCTACAGCCTCAGTGAGCATGTGACTGGAGAGGAGGAGAGGGAACTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1681666 - 1833
Exon 15 To Exon 16 (Pair 5)
Forward (1666,20)CCATGGGTCAGGTCACAGAGAmplicon SizecDNA: 172 bpgenomic: 86,773
Reverse (1837,19)GGCGGCAGTTCCCTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.324 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops1.455 kcal/mol
Reverse Dimers-1.616 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.993 kcal/mol outside primersite
Amplicon SequenceCCATGGGTCAGGTCACAGAGAAGCTGCAGCTGACTTACATGGAGGAGACGTGTCGTCACT
ATGTGGCCCATGTGAAGCGGAGGGTGCAGGACGTCATCAGCCCGATCGTGTTTGAAGCAG
CCTACAGCCTCAGTGAGCATGTGACTGGAGAGGAGGAGAGGGAACTGCCGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1721666 - 1837
Exon 15 To Exon 16 (Pair 6)
Forward (1666,20)CCATGGGTCAGGTCACAGAGAmplicon SizecDNA: 152 bpgenomic: 86,753
Reverse (1817,21)CTCTCCAGTCACATGCTCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.324 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops1.219 kcal/mol in 3' area
Reverse Dimers-1.092 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.993 kcal/mol outside primersite
Amplicon SequenceCCATGGGTCAGGTCACAGAGAAGCTGCAGCTGACTTACATGGAGGAGACGTGTCGTCACT
ATGTGGCCCATGTGAAGCGGAGGGTGCAGGACGTCATCAGCCCGATCGTGTTTGAAGCAG
CCTACAGCCTCAGTGAGCATGTGACTGGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1521666 - 1817
Exon 15 To Exon 16 (Pair 7)
Forward (1666,20)CCATGGGTCAGGTCACAGAGAmplicon SizecDNA: 161 bpgenomic: 86,762
Reverse (1826,20)CCTCTCCTCCTCTCCAGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.324 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops2.589 kcal/mol in 3' area
Reverse Dimers0.371 kcal/mol in 3' area
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.993 kcal/mol outside primersite
Amplicon SequenceCCATGGGTCAGGTCACAGAGAAGCTGCAGCTGACTTACATGGAGGAGACGTGTCGTCACT
ATGTGGCCCATGTGAAGCGGAGGGTGCAGGACGTCATCAGCCCGATCGTGTTTGAAGCAG
CCTACAGCCTCAGTGAGCATGTGACTGGAGAGGAGGAGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1611666 - 1826
Exon 15 To Exon 16 (Pair 8)
Forward (1666,20)CCATGGGTCAGGTCACAGAGAmplicon SizecDNA: 171 bpgenomic: 86,772
Reverse (1836,19)GCGGCAGTTCCCTCTCCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.324 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops1.455 kcal/mol
Reverse Dimers-1.034 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.993 kcal/mol outside primersite
Amplicon SequenceCCATGGGTCAGGTCACAGAGAAGCTGCAGCTGACTTACATGGAGGAGACGTGTCGTCACT
ATGTGGCCCATGTGAAGCGGAGGGTGCAGGACGTCATCAGCCCGATCGTGTTTGAAGCAG
CCTACAGCCTCAGTGAGCATGTGACTGGAGAGGAGGAGAGGGAACTGCCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1711666 - 1836
Exon 15 To Exon 16 (Pair 9)
Forward (1666,20)CCATGGGTCAGGTCACAGAGAmplicon SizecDNA: 166 bpgenomic: 86,767
Reverse (1831,20)AGTTCCCTCTCCTCCTCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.324 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops1.929 kcal/mol
Reverse Dimers0.845 kcal/mol in 3' area
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.993 kcal/mol outside primersite
Amplicon SequenceCCATGGGTCAGGTCACAGAGAAGCTGCAGCTGACTTACATGGAGGAGACGTGTCGTCACT
ATGTGGCCCATGTGAAGCGGAGGGTGCAGGACGTCATCAGCCCGATCGTGTTTGAAGCAG
CCTACAGCCTCAGTGAGCATGTGACTGGAGAGGAGGAGAGGGAACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1661666 - 1831
Exon 15 To Exon 16 (Pair 10)
Forward (1666,20)CCATGGGTCAGGTCACAGAGAmplicon SizecDNA: 167 bpgenomic: 86,768
Reverse (1832,20)CAGTTCCCTCTCCTCCTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.324 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops1.455 kcal/mol
Reverse Dimers0.371 kcal/mol in 3' area
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.993 kcal/mol outside primersite
Amplicon SequenceCCATGGGTCAGGTCACAGAGAAGCTGCAGCTGACTTACATGGAGGAGACGTGTCGTCACT
ATGTGGCCCATGTGAAGCGGAGGGTGCAGGACGTCATCAGCCCGATCGTGTTTGAAGCAG
CCTACAGCCTCAGTGAGCATGTGACTGGAGAGGAGGAGAGGGAACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1671666 - 1832
Exon 15 To Exon 16 (Pair 11)
Forward (1666,20)CCATGGGTCAGGTCACAGAGAmplicon SizecDNA: 164 bpgenomic: 86,765
Reverse (1829,20)TTCCCTCTCCTCCTCTCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.324 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops2.617 kcal/mol in 3' area
Reverse Dimers0.399 kcal/mol in 3' area
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.993 kcal/mol outside primersite
Amplicon SequenceCCATGGGTCAGGTCACAGAGAAGCTGCAGCTGACTTACATGGAGGAGACGTGTCGTCACT
ATGTGGCCCATGTGAAGCGGAGGGTGCAGGACGTCATCAGCCCGATCGTGTTTGAAGCAG
CCTACAGCCTCAGTGAGCATGTGACTGGAGAGGAGGAGAGGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1641666 - 1829
Exon 15 To Exon 16 (Pair 12)
Forward (1666,20)CCATGGGTCAGGTCACAGAGAmplicon SizecDNA: 170 bpgenomic: 86,771
Reverse (1835,19)CGGCAGTTCCCTCTCCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.324 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops1.455 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.993 kcal/mol outside primersite
Amplicon SequenceCCATGGGTCAGGTCACAGAGAAGCTGCAGCTGACTTACATGGAGGAGACGTGTCGTCACT
ATGTGGCCCATGTGAAGCGGAGGGTGCAGGACGTCATCAGCCCGATCGTGTTTGAAGCAG
CCTACAGCCTCAGTGAGCATGTGACTGGAGAGGAGGAGAGGGAACTGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1701666 - 1835
Exon 17 To Exon 18 (Pair 1)
Forward (1941,21)CAGCTTCAGGGTAAACTGCTGAmplicon SizecDNA: 105 bpgenomic: 30,179
Reverse (2045,23)GAGGTTGGAGATAGAGATGTTTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.997 kcal/mol in 3' area
Forward Dimers-2.77 kcal/mol
Reverse Loops1.481 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.27 kcal/mol outside primersite
Amplicon SequenceCAGCTTCAGGGTAAACTGCTGCTCTCCAGTATGGATGAGAAAACCCTGTATCTAGCTTTG
GGGGCTGTGAAGAACATCTCCCTAAACATCTCTATCTCCAACCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1051941 - 2045
Exon 17 To Exon 18 (Pair 2)
Forward (1942,21)AGCTTCAGGGTAAACTGCTGCAmplicon SizecDNA: 104 bpgenomic: 30,178
Reverse (2045,23)GAGGTTGGAGATAGAGATGTTTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.365 kcal/mol in 3' area
Forward Dimers-1.822 kcal/mol
Reverse Loops1.481 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.27 kcal/mol outside primersite
Amplicon SequenceAGCTTCAGGGTAAACTGCTGCTCTCCAGTATGGATGAGAAAACCCTGTATCTAGCTTTGG
GGGCTGTGAAGAACATCTCCCTAAACATCTCTATCTCCAACCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1041942 - 2045
Exon 17 To Exon 18 (Pair 3)
Forward (1942,21)AGCTTCAGGGTAAACTGCTGCAmplicon SizecDNA: 106 bpgenomic: 30,180
Reverse (2047,21)CCGAGGTTGGAGATAGAGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.365 kcal/mol in 3' area
Forward Dimers-1.822 kcal/mol
Reverse Loops1.081 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.27 kcal/mol outside primersite
Amplicon SequenceAGCTTCAGGGTAAACTGCTGCTCTCCAGTATGGATGAGAAAACCCTGTATCTAGCTTTGG
GGGCTGTGAAGAACATCTCCCTAAACATCTCTATCTCCAACCTCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1061942 - 2047
Exon 17 To Exon 18 (Pair 4)
Forward (1941,21)CAGCTTCAGGGTAAACTGCTGAmplicon SizecDNA: 107 bpgenomic: 30,181
Reverse (2047,21)CCGAGGTTGGAGATAGAGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.997 kcal/mol in 3' area
Forward Dimers-2.77 kcal/mol
Reverse Loops1.081 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.27 kcal/mol outside primersite
Amplicon SequenceCAGCTTCAGGGTAAACTGCTGCTCTCCAGTATGGATGAGAAAACCCTGTATCTAGCTTTG
GGGGCTGTGAAGAACATCTCCCTAAACATCTCTATCTCCAACCTCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1071941 - 2047
Exon 17 To Exon 18 (Pair 5)
Forward (1941,21)CAGCTTCAGGGTAAACTGCTGAmplicon SizecDNA: 106 bpgenomic: 30,180
Reverse (2046,22)CGAGGTTGGAGATAGAGATGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.997 kcal/mol in 3' area
Forward Dimers-2.77 kcal/mol
Reverse Loops1.481 kcal/mol in 3' area
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.27 kcal/mol outside primersite
Amplicon SequenceCAGCTTCAGGGTAAACTGCTGCTCTCCAGTATGGATGAGAAAACCCTGTATCTAGCTTTG
GGGGCTGTGAAGAACATCTCCCTAAACATCTCTATCTCCAACCTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1061941 - 2046
Exon 17 To Exon 18 (Pair 6)
Forward (1942,21)AGCTTCAGGGTAAACTGCTGCAmplicon SizecDNA: 105 bpgenomic: 30,179
Reverse (2046,22)CGAGGTTGGAGATAGAGATGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.365 kcal/mol in 3' area
Forward Dimers-1.822 kcal/mol
Reverse Loops1.481 kcal/mol in 3' area
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.27 kcal/mol outside primersite
Amplicon SequenceAGCTTCAGGGTAAACTGCTGCTCTCCAGTATGGATGAGAAAACCCTGTATCTAGCTTTGG
GGGCTGTGAAGAACATCTCCCTAAACATCTCTATCTCCAACCTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1051942 - 2046
Exon 18 To Exon 19 (Pair 1)
Forward (2042,21)CCTCGGAGATGATGCCTATGAAmplicon SizecDNA: 155 bpgenomic: 48,851
Reverse (2196,22)ACCTCATGAAAGGAAATCCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.505 kcal/mol
Reverse Dimers-2.057 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTT
CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTT
CCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1552042 - 2196
Exon 18 To Exon 20 (Pair 1)
Forward (2046,21)GGAGATGATGCCTATGATGCCAmplicon SizecDNA: 192 bpgenomic: 52,993
Reverse (2237,22)GCTTGTATCAAAGATCACGCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.956 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCATC
AACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCTC
AAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGTGATC
TTTGATACAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1922046 - 2237
Exon 18 To Exon 19 (Pair 2)
Forward (2046,21)GGAGATGATGCCTATGATGCCAmplicon SizecDNA: 151 bpgenomic: 48,847
Reverse (2196,22)ACCTCATGAAAGGAAATCCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.956 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops0.505 kcal/mol
Reverse Dimers-2.057 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCATC
AACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCTC
AAATGCAGCGTGGGATTTCCTTTCATGAGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1512046 - 2196
Exon 18 To Exon 20 (Pair 2)
Forward (2038,20)CCAACCTCGGAGATGATGCCAmplicon SizecDNA: 241 bpgenomic: 53,042
Reverse (2278,23)GTAACAATGAAGCTGAGAACTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.372 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCT
TCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGG
ACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCA
GCGTGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTGTTA
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2412038 - 2278
Exon 18 To Exon 20 (Pair 3)
Forward (2038,20)CCAACCTCGGAGATGATGCCAmplicon SizecDNA: 243 bpgenomic: 53,044
Reverse (2280,23)CAGTAACAATGAAGCTGAGAACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.368 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCT
TCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGG
ACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCA
GCGTGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTGTTA
CTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2432038 - 2280
Exon 18 To Exon 20 (Pair 4)
Forward (2039,21)CAACCTCGGAGATGATGCCTAAmplicon SizecDNA: 242 bpgenomic: 53,043
Reverse (2280,23)CAGTAACAATGAAGCTGAGAACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.368 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTT
CTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGA
CTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAG
CGTGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTGTTAC
TG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2422039 - 2280
Exon 18 To Exon 20 (Pair 5)
Forward (2041,21)ACCTCGGAGATGATGCCTATGAmplicon SizecDNA: 240 bpgenomic: 53,041
Reverse (2280,23)CAGTAACAATGAAGCTGAGAACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.368 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCT
TCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACT
TCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCG
TGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTGTTACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2402041 - 2280
Exon 18 To Exon 19 (Pair 3)
Forward (2039,21)CAACCTCGGAGATGATGCCTAAmplicon SizecDNA: 159 bpgenomic: 48,855
Reverse (2197,22)GACCTCATGAAAGGAAATCCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.505 kcal/mol
Reverse Dimers-2.057 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTT
CTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGA
CTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1592039 - 2197
Exon 18 To Exon 20 (Pair 6)
Forward (2090,22)GGAGCTCTTCTTCATCAACATGAmplicon SizecDNA: 148 bpgenomic: 52,949
Reverse (2237,22)GCTTGTATCAAAGATCACGCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.107 kcal/mol
Forward Dimers-2.968 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGCTCTTCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCT
GGAATCGGACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTA
TGAATTCAGCGTGATCTTTGATACAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1482090 - 2237
Exon 18 To Exon 20 (Pair 7)
Forward (2090,22)GGAGCTCTTCTTCATCAACATGAmplicon SizecDNA: 149 bpgenomic: 52,950
Reverse (2238,22)GGCTTGTATCAAAGATCACGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.107 kcal/mol
Forward Dimers-2.968 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGCTCTTCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCT
GGAATCGGACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTA
TGAATTCAGCGTGATCTTTGATACAAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1492090 - 2238
Exon 18 To Exon 20 (Pair 8)
Forward (2042,21)CCTCGGAGATGATGCCTATGAAmplicon SizecDNA: 233 bpgenomic: 53,034
Reverse (2274,22)CAATGAAGCTGAGAACTTCCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.372 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTT
CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTT
CCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGT
GATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2332042 - 2274
Exon 18 To Exon 20 (Pair 9)
Forward (2041,21)ACCTCGGAGATGATGCCTATGAmplicon SizecDNA: 228 bpgenomic: 53,029
Reverse (2268,21)AGCTGAGAACTTCCTCTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.365 kcal/mol in 3' area
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCT
TCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACT
TCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCG
TGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2282041 - 2268
Exon 18 To Exon 20 (Pair 10)
Forward (2041,21)ACCTCGGAGATGATGCCTATGAmplicon SizecDNA: 197 bpgenomic: 52,998
Reverse (2237,22)GCTTGTATCAAAGATCACGCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCT
TCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACT
TCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCG
TGATCTTTGATACAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1972041 - 2237
Exon 18 To Exon 20 (Pair 11)
Forward (2042,21)CCTCGGAGATGATGCCTATGAAmplicon SizecDNA: 202 bpgenomic: 53,003
Reverse (2243,22)CAGGTGGCTTGTATCAAAGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.237 kcal/mol
Reverse Dimers-2.879 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTT
CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTT
CCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGT
GATCTTTGATACAAGCCACCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2022042 - 2243
Exon 18 To Exon 20 (Pair 12)
Forward (2046,21)GGAGATGATGCCTATGATGCCAmplicon SizecDNA: 231 bpgenomic: 53,032
Reverse (2276,23)AACAATGAAGCTGAGAACTTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.956 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops1.372 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCATC
AACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCTC
AAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGTGATC
TTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2312046 - 2276
Exon 18 To Exon 20 (Pair 13)
Forward (2090,22)GGAGCTCTTCTTCATCAACATGAmplicon SizecDNA: 157 bpgenomic: 52,958
Reverse (2246,22)AGACAGGTGGCTTGTATCAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.107 kcal/mol
Forward Dimers-2.968 kcal/mol
Reverse Loops0.868 kcal/mol
Reverse Dimers-2.879 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGCTCTTCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCT
GGAATCGGACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTA
TGAATTCAGCGTGATCTTTGATACAAGCCACCTGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1572090 - 2246
Exon 18 To Exon 20 (Pair 14)
Forward (2045,21)CGGAGATGATGCCTATGATGCAmplicon SizecDNA: 204 bpgenomic: 53,005
Reverse (2248,21)CCAGACAGGTGGCTTGTATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.154 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops0.868 kcal/mol in 3' area
Reverse Dimers-2.879 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCAT
CAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCT
CAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGTGAT
CTTTGATACAAGCCACCTGTCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2042045 - 2248
Exon 18 To Exon 20 (Pair 15)
Forward (2045,21)CGGAGATGATGCCTATGATGCAmplicon SizecDNA: 233 bpgenomic: 53,034
Reverse (2277,23)TAACAATGAAGCTGAGAACTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.154 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops1.372 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCAT
CAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCT
CAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGTGAT
CTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTGTTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2332045 - 2277
Exon 18 To Exon 20 (Pair 16)
Forward (2090,22)GGAGCTCTTCTTCATCAACATGAmplicon SizecDNA: 188 bpgenomic: 52,989
Reverse (2277,23)TAACAATGAAGCTGAGAACTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.107 kcal/mol
Forward Dimers-2.968 kcal/mol
Reverse Loops1.372 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGCTCTTCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCT
GGAATCGGACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTA
TGAATTCAGCGTGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTT
CATTGTTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1882090 - 2277
Exon 18 To Exon 20 (Pair 17)
Forward (2038,20)CCAACCTCGGAGATGATGCCAmplicon SizecDNA: 204 bpgenomic: 53,005
Reverse (2241,22)GGTGGCTTGTATCAAAGATCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCT
TCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGG
ACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCA
GCGTGATCTTTGATACAAGCCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2042038 - 2241
Exon 18 To Exon 20 (Pair 18)
Forward (2042,21)CCTCGGAGATGATGCCTATGAAmplicon SizecDNA: 195 bpgenomic: 52,996
Reverse (2236,23)CTTGTATCAAAGATCACGCTGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.542 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTT
CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTT
CCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGT
GATCTTTGATACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1952042 - 2236
Exon 18 To Exon 19 (Pair 4)
Forward (2090,22)GGAGCTCTTCTTCATCAACATGAmplicon SizecDNA: 83 bpgenomic: 48,779
Reverse (2172,22)TGCATTTGAGGAAGTCCGATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.107 kcal/mol
Forward Dimers-2.968 kcal/mol
Reverse Loops1.464 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.644 kcal/mol outside primersite
Amplicon SequenceGGAGCTCTTCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCT
GGAATCGGACTTCCTCAAATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)832090 - 2172
Exon 18 To Exon 20 (Pair 19)
Forward (2038,20)CCAACCTCGGAGATGATGCCAmplicon SizecDNA: 198 bpgenomic: 52,999
Reverse (2235,24)TTGTATCAAAGATCACGCTGAATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.542 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCT
TCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGG
ACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCA
GCGTGATCTTTGATACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1982038 - 2235
Exon 18 To Exon 20 (Pair 20)
Forward (2039,21)CAACCTCGGAGATGATGCCTAAmplicon SizecDNA: 197 bpgenomic: 52,998
Reverse (2235,24)TTGTATCAAAGATCACGCTGAATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.542 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTT
CTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGA
CTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAG
CGTGATCTTTGATACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1972039 - 2235
Exon 18 To Exon 19 (Pair 5)
Forward (2042,21)CCTCGGAGATGATGCCTATGAAmplicon SizecDNA: 156 bpgenomic: 48,852
Reverse (2197,22)GACCTCATGAAAGGAAATCCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.505 kcal/mol
Reverse Dimers-2.057 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTT
CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTT
CCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1562042 - 2197
Exon 18 To Exon 20 (Pair 21)
Forward (2039,21)CAACCTCGGAGATGATGCCTAAmplicon SizecDNA: 209 bpgenomic: 53,010
Reverse (2247,22)CAGACAGGTGGCTTGTATCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.868 kcal/mol
Reverse Dimers-2.879 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTT
CTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGA
CTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAG
CGTGATCTTTGATACAAGCCACCTGTCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2092039 - 2247
Exon 18 To Exon 20 (Pair 22)
Forward (2038,20)CCAACCTCGGAGATGATGCCAmplicon SizecDNA: 237 bpgenomic: 53,038
Reverse (2274,22)CAATGAAGCTGAGAACTTCCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.372 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCT
TCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGG
ACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCA
GCGTGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2372038 - 2274
Exon 18 To Exon 20 (Pair 23)
Forward (2042,21)CCTCGGAGATGATGCCTATGAAmplicon SizecDNA: 232 bpgenomic: 53,033
Reverse (2273,23)AATGAAGCTGAGAACTTCCTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.365 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTT
CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTT
CCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGT
GATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2322042 - 2273
Exon 18 To Exon 20 (Pair 24)
Forward (2041,21)ACCTCGGAGATGATGCCTATGAmplicon SizecDNA: 200 bpgenomic: 53,001
Reverse (2240,22)GTGGCTTGTATCAAAGATCACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCT
TCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACT
TCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCG
TGATCTTTGATACAAGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2002041 - 2240
Exon 18 To Exon 20 (Pair 25)
Forward (2041,21)ACCTCGGAGATGATGCCTATGAmplicon SizecDNA: 233 bpgenomic: 53,034
Reverse (2273,23)AATGAAGCTGAGAACTTCCTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.365 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCT
TCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACT
TCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCG
TGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2332041 - 2273
Exon 18 To Exon 19 (Pair 6)
Forward (2039,21)CAACCTCGGAGATGATGCCTAAmplicon SizecDNA: 160 bpgenomic: 48,856
Reverse (2198,22)TGACCTCATGAAAGGAAATCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.505 kcal/mol
Reverse Dimers-2.057 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTT
CTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGA
CTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1602039 - 2198
Exon 18 To Exon 19 (Pair 7)
Forward (2090,22)GGAGCTCTTCTTCATCAACATGAmplicon SizecDNA: 74 bpgenomic: 48,770
Reverse (2163,20)GGAAGTCCGATTCCAGCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.107 kcal/mol
Forward Dimers-2.968 kcal/mol
Reverse Loops0.901 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.644 kcal/mol outside primersite
Amplicon SequenceGGAGCTCTTCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCT
GGAATCGGACTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)742090 - 2163
Exon 18 To Exon 19 (Pair 8)
Forward (2039,21)CAACCTCGGAGATGATGCCTAAmplicon SizecDNA: 162 bpgenomic: 48,858
Reverse (2200,23)TTTGACCTCATGAAAGGAAATCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.505 kcal/mol
Reverse Dimers-2.057 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTT
CTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGA
CTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1622039 - 2200
Exon 18 To Exon 20 (Pair 26)
Forward (2042,21)CCTCGGAGATGATGCCTATGAAmplicon SizecDNA: 239 bpgenomic: 53,040
Reverse (2280,23)CAGTAACAATGAAGCTGAGAACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.368 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTT
CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTT
CCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGT
GATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTGTTACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2392042 - 2280
Exon 18 To Exon 20 (Pair 27)
Forward (2090,22)GGAGCTCTTCTTCATCAACATGAmplicon SizecDNA: 150 bpgenomic: 52,951
Reverse (2239,22)TGGCTTGTATCAAAGATCACGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.107 kcal/mol
Forward Dimers-2.968 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGCTCTTCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCT
GGAATCGGACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTA
TGAATTCAGCGTGATCTTTGATACAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1502090 - 2239
Exon 18 To Exon 20 (Pair 28)
Forward (2041,21)ACCTCGGAGATGATGCCTATGAmplicon SizecDNA: 206 bpgenomic: 53,007
Reverse (2246,22)AGACAGGTGGCTTGTATCAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.868 kcal/mol
Reverse Dimers-2.879 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCT
TCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACT
TCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCG
TGATCTTTGATACAAGCCACCTGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2062041 - 2246
Exon 18 To Exon 20 (Pair 29)
Forward (2090,22)GGAGCTCTTCTTCATCAACATGAmplicon SizecDNA: 158 bpgenomic: 52,959
Reverse (2247,22)CAGACAGGTGGCTTGTATCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.107 kcal/mol
Forward Dimers-2.968 kcal/mol
Reverse Loops0.868 kcal/mol
Reverse Dimers-2.879 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGCTCTTCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCT
GGAATCGGACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTA
TGAATTCAGCGTGATCTTTGATACAAGCCACCTGTCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1582090 - 2247
Exon 18 To Exon 20 (Pair 30)
Forward (2038,20)CCAACCTCGGAGATGATGCCAmplicon SizecDNA: 236 bpgenomic: 53,037
Reverse (2273,23)AATGAAGCTGAGAACTTCCTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.365 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCT
TCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGG
ACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCA
GCGTGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2362038 - 2273
Exon 18 To Exon 20 (Pair 31)
Forward (2039,21)CAACCTCGGAGATGATGCCTAAmplicon SizecDNA: 238 bpgenomic: 53,039
Reverse (2276,23)AACAATGAAGCTGAGAACTTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.372 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTT
CTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGA
CTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAG
CGTGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2382039 - 2276
Exon 18 To Exon 19 (Pair 9)
Forward (2038,20)CCAACCTCGGAGATGATGCCAmplicon SizecDNA: 159 bpgenomic: 48,855
Reverse (2196,22)ACCTCATGAAAGGAAATCCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.505 kcal/mol
Reverse Dimers-2.057 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCT
TCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGG
ACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1592038 - 2196
Exon 18 To Exon 20 (Pair 32)
Forward (2045,21)CGGAGATGATGCCTATGATGCAmplicon SizecDNA: 232 bpgenomic: 53,033
Reverse (2276,23)AACAATGAAGCTGAGAACTTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.154 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops1.372 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCAT
CAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCT
CAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGTGAT
CTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2322045 - 2276
Exon 18 To Exon 20 (Pair 33)
Forward (2046,21)GGAGATGATGCCTATGATGCCAmplicon SizecDNA: 232 bpgenomic: 53,033
Reverse (2277,23)TAACAATGAAGCTGAGAACTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.956 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops1.372 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCATC
AACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCTC
AAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGTGATC
TTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTGTTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2322046 - 2277
Exon 18 To Exon 20 (Pair 34)
Forward (2042,21)CCTCGGAGATGATGCCTATGAAmplicon SizecDNA: 196 bpgenomic: 52,997
Reverse (2237,22)GCTTGTATCAAAGATCACGCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTT
CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTT
CCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGT
GATCTTTGATACAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1962042 - 2237
Exon 18 To Exon 20 (Pair 35)
Forward (2038,20)CCAACCTCGGAGATGATGCCAmplicon SizecDNA: 211 bpgenomic: 53,012
Reverse (2248,21)CCAGACAGGTGGCTTGTATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.868 kcal/mol in 3' area
Reverse Dimers-2.879 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCT
TCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGG
ACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCA
GCGTGATCTTTGATACAAGCCACCTGTCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2112038 - 2248
Exon 18 To Exon 20 (Pair 36)
Forward (2038,20)CCAACCTCGGAGATGATGCCAmplicon SizecDNA: 203 bpgenomic: 53,004
Reverse (2240,22)GTGGCTTGTATCAAAGATCACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCT
TCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGG
ACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCA
GCGTGATCTTTGATACAAGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2032038 - 2240
Exon 18 To Exon 19 (Pair 10)
Forward (2039,21)CAACCTCGGAGATGATGCCTAAmplicon SizecDNA: 168 bpgenomic: 48,864
Reverse (2206,23)TTTGACTTTGACCTCATGAAAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.316 kcal/mol in 3' area
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTT
CTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGA
CTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1682039 - 2206
Exon 18 To Exon 19 (Pair 11)
Forward (2090,22)GGAGCTCTTCTTCATCAACATGAmplicon SizecDNA: 107 bpgenomic: 48,803
Reverse (2196,22)ACCTCATGAAAGGAAATCCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.107 kcal/mol
Forward Dimers-2.968 kcal/mol
Reverse Loops0.505 kcal/mol
Reverse Dimers-2.057 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGCTCTTCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCT
GGAATCGGACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1072090 - 2196
Exon 18 To Exon 20 (Pair 37)
Forward (2039,21)CAACCTCGGAGATGATGCCTAAmplicon SizecDNA: 239 bpgenomic: 53,040
Reverse (2277,23)TAACAATGAAGCTGAGAACTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.372 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTT
CTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGA
CTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAG
CGTGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTGTTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2392039 - 2277
Exon 18 To Exon 20 (Pair 38)
Forward (2045,21)CGGAGATGATGCCTATGATGCAmplicon SizecDNA: 195 bpgenomic: 52,996
Reverse (2239,22)TGGCTTGTATCAAAGATCACGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.154 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCAT
CAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCT
CAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGTGAT
CTTTGATACAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1952045 - 2239
Exon 18 To Exon 20 (Pair 39)
Forward (2090,22)GGAGCTCTTCTTCATCAACATGAmplicon SizecDNA: 187 bpgenomic: 52,988
Reverse (2276,23)AACAATGAAGCTGAGAACTTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.107 kcal/mol
Forward Dimers-2.968 kcal/mol
Reverse Loops1.372 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGCTCTTCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCT
GGAATCGGACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTA
TGAATTCAGCGTGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTT
CATTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1872090 - 2276
Exon 18 To Exon 19 (Pair 12)
Forward (2038,20)CCAACCTCGGAGATGATGCCAmplicon SizecDNA: 163 bpgenomic: 48,859
Reverse (2200,23)TTTGACCTCATGAAAGGAAATCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.505 kcal/mol
Reverse Dimers-2.057 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCT
TCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGG
ACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1632038 - 2200
Exon 18 To Exon 20 (Pair 40)
Forward (2042,21)CCTCGGAGATGATGCCTATGAAmplicon SizecDNA: 200 bpgenomic: 53,001
Reverse (2241,22)GGTGGCTTGTATCAAAGATCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTT
CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTT
CCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGT
GATCTTTGATACAAGCCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2002042 - 2241
Exon 18 To Exon 20 (Pair 41)
Forward (2090,22)GGAGCTCTTCTTCATCAACATGAmplicon SizecDNA: 191 bpgenomic: 52,992
Reverse (2280,23)CAGTAACAATGAAGCTGAGAACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.107 kcal/mol
Forward Dimers-2.968 kcal/mol
Reverse Loops1.368 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGCTCTTCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCT
GGAATCGGACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTA
TGAATTCAGCGTGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTT
CATTGTTACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1912090 - 2280
Exon 18 To Exon 20 (Pair 42)
Forward (2039,21)CAACCTCGGAGATGATGCCTAAmplicon SizecDNA: 198 bpgenomic: 52,999
Reverse (2236,23)CTTGTATCAAAGATCACGCTGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.542 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTT
CTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGA
CTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAG
CGTGATCTTTGATACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1982039 - 2236
Exon 18 To Exon 19 (Pair 13)
Forward (2041,21)ACCTCGGAGATGATGCCTATGAmplicon SizecDNA: 158 bpgenomic: 48,854
Reverse (2198,22)TGACCTCATGAAAGGAAATCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.505 kcal/mol
Reverse Dimers-2.057 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCT
TCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACT
TCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1582041 - 2198
Exon 18 To Exon 19 (Pair 14)
Forward (2042,21)CCTCGGAGATGATGCCTATGAAmplicon SizecDNA: 157 bpgenomic: 48,853
Reverse (2198,22)TGACCTCATGAAAGGAAATCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.505 kcal/mol
Reverse Dimers-2.057 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTT
CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTT
CCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1572042 - 2198
Exon 18 To Exon 19 (Pair 15)
Forward (2045,21)CGGAGATGATGCCTATGATGCAmplicon SizecDNA: 154 bpgenomic: 48,850
Reverse (2198,22)TGACCTCATGAAAGGAAATCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.154 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops0.505 kcal/mol
Reverse Dimers-2.057 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCAT
CAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCT
CAAATGCAGCGTGGGATTTCCTTTCATGAGGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1542045 - 2198
Exon 18 To Exon 20 (Pair 43)
Forward (2045,21)CGGAGATGATGCCTATGATGCAmplicon SizecDNA: 197 bpgenomic: 52,998
Reverse (2241,22)GGTGGCTTGTATCAAAGATCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.154 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCAT
CAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCT
CAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGTGAT
CTTTGATACAAGCCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1972045 - 2241
Exon 18 To Exon 20 (Pair 44)
Forward (2046,21)GGAGATGATGCCTATGATGCCAmplicon SizecDNA: 193 bpgenomic: 52,994
Reverse (2238,22)GGCTTGTATCAAAGATCACGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.956 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCATC
AACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCTC
AAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGTGATC
TTTGATACAAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1932046 - 2238
Exon 18 To Exon 19 (Pair 16)
Forward (2046,21)GGAGATGATGCCTATGATGCCAmplicon SizecDNA: 127 bpgenomic: 48,823
Reverse (2172,22)TGCATTTGAGGAAGTCCGATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.956 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops1.464 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.644 kcal/mol outside primersite
Amplicon SequenceGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCATC
AACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCTC
AAATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1272046 - 2172
Exon 18 To Exon 20 (Pair 45)
Forward (2038,20)CCAACCTCGGAGATGATGCCAmplicon SizecDNA: 234 bpgenomic: 53,035
Reverse (2271,22)TGAAGCTGAGAACTTCCTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.365 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCT
TCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGG
ACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCA
GCGTGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2342038 - 2271
Exon 18 To Exon 20 (Pair 46)
Forward (2090,22)GGAGCTCTTCTTCATCAACATGAmplicon SizecDNA: 152 bpgenomic: 52,953
Reverse (2241,22)GGTGGCTTGTATCAAAGATCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.107 kcal/mol
Forward Dimers-2.968 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGCTCTTCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCT
GGAATCGGACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTA
TGAATTCAGCGTGATCTTTGATACAAGCCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1522090 - 2241
Exon 18 To Exon 20 (Pair 47)
Forward (2046,21)GGAGATGATGCCTATGATGCCAmplicon SizecDNA: 190 bpgenomic: 52,991
Reverse (2235,24)TTGTATCAAAGATCACGCTGAATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.956 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops1.542 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCATC
AACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCTC
AAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGTGATC
TTTGATACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1902046 - 2235
Exon 18 To Exon 20 (Pair 48)
Forward (2041,21)ACCTCGGAGATGATGCCTATGAmplicon SizecDNA: 201 bpgenomic: 53,002
Reverse (2241,22)GGTGGCTTGTATCAAAGATCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCT
TCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACT
TCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCG
TGATCTTTGATACAAGCCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2012041 - 2241
Exon 18 To Exon 19 (Pair 17)
Forward (2038,20)CCAACCTCGGAGATGATGCCAmplicon SizecDNA: 169 bpgenomic: 48,865
Reverse (2206,23)TTTGACTTTGACCTCATGAAAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.316 kcal/mol in 3' area
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCT
TCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGG
ACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1692038 - 2206
Exon 18 To Exon 19 (Pair 18)
Forward (2045,21)CGGAGATGATGCCTATGATGCAmplicon SizecDNA: 128 bpgenomic: 48,824
Reverse (2172,22)TGCATTTGAGGAAGTCCGATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.154 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops1.464 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.644 kcal/mol outside primersite
Amplicon SequenceCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCAT
CAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCT
CAAATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1282045 - 2172
Exon 18 To Exon 19 (Pair 19)
Forward (2041,21)ACCTCGGAGATGATGCCTATGAmplicon SizecDNA: 123 bpgenomic: 48,819
Reverse (2163,20)GGAAGTCCGATTCCAGCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.901 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.644 kcal/mol outside primersite
Amplicon SequenceACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCT
TCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACT
TCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1232041 - 2163
Exon 18 To Exon 19 (Pair 20)
Forward (2038,20)CCAACCTCGGAGATGATGCCAmplicon SizecDNA: 160 bpgenomic: 48,856
Reverse (2197,22)GACCTCATGAAAGGAAATCCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.505 kcal/mol
Reverse Dimers-2.057 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCT
TCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGG
ACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1602038 - 2197
Exon 18 To Exon 20 (Pair 49)
Forward (2045,21)CGGAGATGATGCCTATGATGCAmplicon SizecDNA: 194 bpgenomic: 52,995
Reverse (2238,22)GGCTTGTATCAAAGATCACGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.154 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCAT
CAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCT
CAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGTGAT
CTTTGATACAAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1942045 - 2238
Exon 18 To Exon 20 (Pair 50)
Forward (2042,21)CCTCGGAGATGATGCCTATGAAmplicon SizecDNA: 207 bpgenomic: 53,008
Reverse (2248,21)CCAGACAGGTGGCTTGTATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.868 kcal/mol in 3' area
Reverse Dimers-2.879 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTT
CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTT
CCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGT
GATCTTTGATACAAGCCACCTGTCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2072042 - 2248
Exon 18 To Exon 20 (Pair 51)
Forward (2039,21)CAACCTCGGAGATGATGCCTAAmplicon SizecDNA: 240 bpgenomic: 53,041
Reverse (2278,23)GTAACAATGAAGCTGAGAACTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.372 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTT
CTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGA
CTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAG
CGTGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTGTTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2402039 - 2278
Exon 18 To Exon 20 (Pair 52)
Forward (2042,21)CCTCGGAGATGATGCCTATGAAmplicon SizecDNA: 227 bpgenomic: 53,028
Reverse (2268,21)AGCTGAGAACTTCCTCTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.365 kcal/mol in 3' area
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTT
CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTT
CCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGT
GATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2272042 - 2268
Exon 18 To Exon 20 (Pair 53)
Forward (2042,21)CCTCGGAGATGATGCCTATGAAmplicon SizecDNA: 236 bpgenomic: 53,037
Reverse (2277,23)TAACAATGAAGCTGAGAACTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.372 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTT
CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTT
CCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGT
GATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTGTTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2362042 - 2277
Exon 18 To Exon 20 (Pair 54)
Forward (2039,21)CAACCTCGGAGATGATGCCTAAmplicon SizecDNA: 205 bpgenomic: 53,006
Reverse (2243,22)CAGGTGGCTTGTATCAAAGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.237 kcal/mol
Reverse Dimers-2.879 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTT
CTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGA
CTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAG
CGTGATCTTTGATACAAGCCACCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2052039 - 2243
Exon 18 To Exon 20 (Pair 55)
Forward (2046,21)GGAGATGATGCCTATGATGCCAmplicon SizecDNA: 229 bpgenomic: 53,030
Reverse (2274,22)CAATGAAGCTGAGAACTTCCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.956 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops1.372 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCATC
AACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCTC
AAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGTGATC
TTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2292046 - 2274
Exon 18 To Exon 20 (Pair 56)
Forward (2041,21)ACCTCGGAGATGATGCCTATGAmplicon SizecDNA: 207 bpgenomic: 53,008
Reverse (2247,22)CAGACAGGTGGCTTGTATCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.868 kcal/mol
Reverse Dimers-2.879 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCT
TCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACT
TCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCG
TGATCTTTGATACAAGCCACCTGTCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2072041 - 2247
Exon 18 To Exon 20 (Pair 57)
Forward (2042,21)CCTCGGAGATGATGCCTATGAAmplicon SizecDNA: 197 bpgenomic: 52,998
Reverse (2238,22)GGCTTGTATCAAAGATCACGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTT
CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTT
CCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGT
GATCTTTGATACAAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1972042 - 2238
Exon 18 To Exon 20 (Pair 58)
Forward (2038,20)CCAACCTCGGAGATGATGCCAmplicon SizecDNA: 239 bpgenomic: 53,040
Reverse (2276,23)AACAATGAAGCTGAGAACTTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.372 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCT
TCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGG
ACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCA
GCGTGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2392038 - 2276
Exon 18 To Exon 20 (Pair 59)
Forward (2046,21)GGAGATGATGCCTATGATGCCAmplicon SizecDNA: 200 bpgenomic: 53,001
Reverse (2245,22)GACAGGTGGCTTGTATCAAAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.956 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops0.868 kcal/mol
Reverse Dimers-2.879 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCATC
AACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCTC
AAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGTGATC
TTTGATACAAGCCACCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2002046 - 2245
Exon 18 To Exon 19 (Pair 21)
Forward (2090,22)GGAGCTCTTCTTCATCAACATGAmplicon SizecDNA: 111 bpgenomic: 48,807
Reverse (2200,23)TTTGACCTCATGAAAGGAAATCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.107 kcal/mol
Forward Dimers-2.968 kcal/mol
Reverse Loops0.505 kcal/mol
Reverse Dimers-2.057 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGCTCTTCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCT
GGAATCGGACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1112090 - 2200
Exon 18 To Exon 20 (Pair 60)
Forward (2046,21)GGAGATGATGCCTATGATGCCAmplicon SizecDNA: 194 bpgenomic: 52,995
Reverse (2239,22)TGGCTTGTATCAAAGATCACGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.956 kcal/mol
Forward Dimers-0.34 kcal/mol
Reverse Loops1.409 kcal/mol
Reverse Dimers-0.881 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTTCATC
AACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTTCCTC
AAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGTGATC
TTTGATACAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)1942046 - 2239
Exon 18 To Exon 20 (Pair 61)
Forward (2042,21)CCTCGGAGATGATGCCTATGAAmplicon SizecDNA: 206 bpgenomic: 53,007
Reverse (2247,22)CAGACAGGTGGCTTGTATCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops0.868 kcal/mol
Reverse Dimers-2.879 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.869 kcal/mol outside primersite
Amplicon SequenceCCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAGCTCTTCTT
CATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAATCGGACTT
CCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAATTCAGCGT
GATCTTTGATACAAGCCACCTGTCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002207 (ITGA9)2062042 - 2247
 

See below for some more details.

Program Output:

Loading ...