Design Results for mecp2

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 3 (Pair 1)
Forward (93,19)GAGCGGAGGAGGAGGAGGAAmplicon SizecDNA: 201 bpgenomic: 39,120
Reverse (293,21)GAACGACAGGCTTGAGAACAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.2 kcal/mol
Reverse Dimers-2.491 kcal/mol
Forward-Reverse Dimers-1.767 kcal/mol
Amplicon Folding-2.444 kcal/mol outside primersite
Amplicon SequenceGAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACC
AGTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGACCAGC
TCCAACAGGATTCCATGGTAGCTGGGATGTTAGGGCTCAGCTGCAAGATGGGATTCAGAT
CTGTTCTCAAGCCTGTCGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 1)
Forward (94,19)AGCGGAGGAGGAGGAGGAGAmplicon SizecDNA: 116 bpgenomic: 5,411
Reverse (209,22)GGTCTACAGAAGCAAGGTGTATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.74 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.621 kcal/mol
Amplicon Folding-0.942 kcal/mol outside primersite
Amplicon SequenceAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACCA
GTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004992 (MECP2)11694 - 209
Exon 1 To Exon 3 (Pair 2)
Forward (93,19)GAGCGGAGGAGGAGGAGGAAmplicon SizecDNA: 198 bpgenomic: 39,117
Reverse (290,21)CGACAGGCTTGAGAACAGATCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.2 kcal/mol
Reverse Dimers-2.491 kcal/mol
Forward-Reverse Dimers-1.767 kcal/mol
Amplicon Folding-2.444 kcal/mol outside primersite
Amplicon SequenceGAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACC
AGTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGACCAGC
TCCAACAGGATTCCATGGTAGCTGGGATGTTAGGGCTCAGCTGCAAGATGGGATTCAGAT
CTGTTCTCAAGCCTGTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 3 (Pair 3)
Forward (93,19)GAGCGGAGGAGGAGGAGGAAmplicon SizecDNA: 202 bpgenomic: 39,121
Reverse (294,21)GGAACGACAGGCTTGAGAACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.2 kcal/mol
Reverse Dimers-2.491 kcal/mol
Forward-Reverse Dimers-1.767 kcal/mol
Amplicon Folding-2.444 kcal/mol outside primersite
Amplicon SequenceGAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACC
AGTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGACCAGC
TCCAACAGGATTCCATGGTAGCTGGGATGTTAGGGCTCAGCTGCAAGATGGGATTCAGAT
CTGTTCTCAAGCCTGTCGTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 3 (Pair 4)
Forward (93,19)GAGCGGAGGAGGAGGAGGAAmplicon SizecDNA: 204 bpgenomic: 39,123
Reverse (296,21)CTGGAACGACAGGCTTGAGAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.2 kcal/mol in 3' area
Reverse Dimers-2.491 kcal/mol
Forward-Reverse Dimers-1.767 kcal/mol
Amplicon Folding-2.444 kcal/mol outside primersite
Amplicon SequenceGAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACC
AGTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGACCAGC
TCCAACAGGATTCCATGGTAGCTGGGATGTTAGGGCTCAGCTGCAAGATGGGATTCAGAT
CTGTTCTCAAGCCTGTCGTTCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 2)
Forward (94,19)AGCGGAGGAGGAGGAGGAGAmplicon SizecDNA: 82 bpgenomic: 5,377
Reverse (175,22)CATGTCACATCAAAGCAGGAACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.416 kcal/mol
Reverse Dimers-2.524 kcal/mol
Forward-Reverse Dimers-0.621 kcal/mol
Amplicon Folding-0.942 kcal/mol outside primersite
Amplicon SequenceAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACCA
GTTCCTGCTTTGATGTGACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004992 (MECP2)8294 - 175
Exon 1 To Exon 3 (Pair 5)
Forward (94,19)AGCGGAGGAGGAGGAGGAGAmplicon SizecDNA: 202 bpgenomic: 39,121
Reverse (295,21)TGGAACGACAGGCTTGAGAACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.2 kcal/mol
Reverse Dimers-2.491 kcal/mol
Forward-Reverse Dimers-1.3 kcal/mol
Amplicon Folding-2.444 kcal/mol outside primersite
Amplicon SequenceAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACCA
GTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGACCAGCT
CCAACAGGATTCCATGGTAGCTGGGATGTTAGGGCTCAGCTGCAAGATGGGATTCAGATC
TGTTCTCAAGCCTGTCGTTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 3)
Forward (94,19)AGCGGAGGAGGAGGAGGAGAmplicon SizecDNA: 118 bpgenomic: 5,413
Reverse (211,21)CTGGTCTACAGAAGCAAGGTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.318 kcal/mol
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-0.621 kcal/mol
Amplicon Folding-0.942 kcal/mol outside primersite
Amplicon SequenceAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACCA
GTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004992 (MECP2)11894 - 211
Exon 1 To Exon 3 (Pair 6)
Forward (93,19)GAGCGGAGGAGGAGGAGGAAmplicon SizecDNA: 200 bpgenomic: 39,119
Reverse (292,22)AACGACAGGCTTGAGAACAGATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.2 kcal/mol
Reverse Dimers-2.491 kcal/mol
Forward-Reverse Dimers-1.767 kcal/mol
Amplicon Folding-2.444 kcal/mol outside primersite
Amplicon SequenceGAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACC
AGTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGACCAGC
TCCAACAGGATTCCATGGTAGCTGGGATGTTAGGGCTCAGCTGCAAGATGGGATTCAGAT
CTGTTCTCAAGCCTGTCGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 3 (Pair 7)
Forward (94,19)AGCGGAGGAGGAGGAGGAGAmplicon SizecDNA: 203 bpgenomic: 39,122
Reverse (296,21)CTGGAACGACAGGCTTGAGAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.2 kcal/mol in 3' area
Reverse Dimers-2.491 kcal/mol
Forward-Reverse Dimers-1.3 kcal/mol
Amplicon Folding-2.444 kcal/mol outside primersite
Amplicon SequenceAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACCA
GTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGACCAGCT
CCAACAGGATTCCATGGTAGCTGGGATGTTAGGGCTCAGCTGCAAGATGGGATTCAGATC
TGTTCTCAAGCCTGTCGTTCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 3 (Pair 8)
Forward (94,19)AGCGGAGGAGGAGGAGGAGAmplicon SizecDNA: 199 bpgenomic: 39,118
Reverse (292,22)AACGACAGGCTTGAGAACAGATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.2 kcal/mol
Reverse Dimers-2.491 kcal/mol
Forward-Reverse Dimers-1.3 kcal/mol
Amplicon Folding-2.444 kcal/mol outside primersite
Amplicon SequenceAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACCA
GTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGACCAGCT
CCAACAGGATTCCATGGTAGCTGGGATGTTAGGGCTCAGCTGCAAGATGGGATTCAGATC
TGTTCTCAAGCCTGTCGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 3 (Pair 9)
Forward (94,19)AGCGGAGGAGGAGGAGGAGAmplicon SizecDNA: 200 bpgenomic: 39,119
Reverse (293,21)GAACGACAGGCTTGAGAACAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.2 kcal/mol
Reverse Dimers-2.491 kcal/mol
Forward-Reverse Dimers-1.3 kcal/mol
Amplicon Folding-2.444 kcal/mol outside primersite
Amplicon SequenceAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACCA
GTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGACCAGCT
CCAACAGGATTCCATGGTAGCTGGGATGTTAGGGCTCAGCTGCAAGATGGGATTCAGATC
TGTTCTCAAGCCTGTCGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 3 (Pair 10)
Forward (94,19)AGCGGAGGAGGAGGAGGAGAmplicon SizecDNA: 197 bpgenomic: 39,116
Reverse (290,21)CGACAGGCTTGAGAACAGATCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.2 kcal/mol
Reverse Dimers-2.491 kcal/mol
Forward-Reverse Dimers-1.204 kcal/mol
Amplicon Folding-2.444 kcal/mol outside primersite
Amplicon SequenceAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACCA
GTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGACCAGCT
CCAACAGGATTCCATGGTAGCTGGGATGTTAGGGCTCAGCTGCAAGATGGGATTCAGATC
TGTTCTCAAGCCTGTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 4)
Forward (94,19)AGCGGAGGAGGAGGAGGAGAmplicon SizecDNA: 117 bpgenomic: 5,412
Reverse (210,22)TGGTCTACAGAAGCAAGGTGTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.74 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.621 kcal/mol
Amplicon Folding-0.942 kcal/mol outside primersite
Amplicon SequenceAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACCA
GTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004992 (MECP2)11794 - 210
Exon 1 To Exon 2 (Pair 5)
Forward (94,19)AGCGGAGGAGGAGGAGGAGAmplicon SizecDNA: 114 bpgenomic: 5,409
Reverse (207,23)TCTACAGAAGCAAGGTGTATTCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.648 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.621 kcal/mol
Amplicon Folding-0.942 kcal/mol outside primersite
Amplicon SequenceAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACCA
GTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004992 (MECP2)11494 - 207
Exon 1 To Exon 3 (Pair 11)
Forward (94,19)AGCGGAGGAGGAGGAGGAGAmplicon SizecDNA: 201 bpgenomic: 39,120
Reverse (294,21)GGAACGACAGGCTTGAGAACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.2 kcal/mol
Reverse Dimers-2.491 kcal/mol
Forward-Reverse Dimers-1.3 kcal/mol
Amplicon Folding-2.444 kcal/mol outside primersite
Amplicon SequenceAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACCA
GTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGACCAGCT
CCAACAGGATTCCATGGTAGCTGGGATGTTAGGGCTCAGCTGCAAGATGGGATTCAGATC
TGTTCTCAAGCCTGTCGTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 3 (Pair 12)
Forward (93,19)GAGCGGAGGAGGAGGAGGAAmplicon SizecDNA: 203 bpgenomic: 39,122
Reverse (295,21)TGGAACGACAGGCTTGAGAACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.2 kcal/mol
Reverse Dimers-2.491 kcal/mol
Forward-Reverse Dimers-1.767 kcal/mol
Amplicon Folding-2.444 kcal/mol outside primersite
Amplicon SequenceGAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGCTCCATAAAAATACAGACTCACC
AGTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGCTTCTGTAGACCAGC
TCCAACAGGATTCCATGGTAGCTGGGATGTTAGGGCTCAGCTGCAAGATGGGATTCAGAT
CTGTTCTCAAGCCTGTCGTTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 74)
Forward (139,22)AATACAGACTCACCAGTTCCTGAmplicon SizecDNA: 152 bpgenomic: 33,776
Reverse (290,21)CGACAGGCTTGAGAACAGATCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.77 kcal/mol
Forward Dimers-1.354 kcal/mol
Reverse Loops1.2 kcal/mol
Reverse Dimers-2.491 kcal/mol
Forward-Reverse Dimers-2.342 kcal/mol
Amplicon Folding-1.502 kcal/mol outside primersite
Amplicon SequenceAATACAGACTCACCAGTTCCTGCTTTGATGTGACATGTGACTCCCCAGAATACACCTTGC
TTCTGTAGACCAGCTCCAACAGGATTCCATGGTAGCTGGGATGTTAGGGCTCAGCTGCAA
GATGGGATTCAGATCTGTTCTCAAGCCTGTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
 

See below for some more details.

Program Output:

Loading ...