Design Results for mki67

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 7 (Pair 1)
Forward (344,23)AAATTGAAATCCATGAGCAGGAGAmplicon SizecDNA: 276 bpgenomic: 7,130
Reverse (619,22)CCTTGGAATCTTGAGCTTTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.257 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops1.318 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceAAATTGAAATCCATGAGCAGGAGGCAATATTACATAATTTCAGTTCCACAAATCCAACAC
AAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAATAACTA
TTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTCAACTG
AATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAGCTTCT
CTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)276344 - 619
Exon 3 To Exon 7 (Pair 2)
Forward (344,23)AAATTGAAATCCATGAGCAGGAGAmplicon SizecDNA: 275 bpgenomic: 7,129
Reverse (618,23)CTTGGAATCTTGAGCTTTCTCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.257 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops0.69 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceAAATTGAAATCCATGAGCAGGAGGCAATATTACATAATTTCAGTTCCACAAATCCAACAC
AAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAATAACTA
TTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTCAACTG
AATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAGCTTCT
CTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)275344 - 618
Exon 4 To Exon 7 (Pair 1)
Forward (378,24)TAATTTCAGTTCCACAAATCCAACAmplicon SizecDNA: 242 bpgenomic: 7,002
Reverse (619,22)CCTTGGAATCTTGAGCTTTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.021 kcal/mol
Forward Dimers-0.959 kcal/mol
Reverse Loops1.318 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceTAATTTCAGTTCCACAAATCCAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACG
GCTAAAACATGGAGATGTAATAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAG
TCTTCAGAATGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGC
ACGTCGTGTCTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAA
GG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)242378 - 619
Exon 4 To Exon 7 (Pair 2)
Forward (399,24)AACACAAGTAAATGGGTCTGTTATAmplicon SizecDNA: 295 bpgenomic: 7,055
Reverse (693,24)ACTGTCTTCTTTGACATTCTTGATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.432 kcal/mol
Forward Dimers-1.28 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.537 kcal/mol outside primersite
Amplicon SequenceAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAAT
AACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTC
AACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAG
CTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAATCACTGA
AGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)295399 - 693
Exon 4 To Exon 7 (Pair 3)
Forward (399,24)AACACAAGTAAATGGGTCTGTTATAmplicon SizecDNA: 220 bpgenomic: 6,980
Reverse (618,23)CTTGGAATCTTGAGCTTTCTCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.432 kcal/mol
Forward Dimers-1.28 kcal/mol
Reverse Loops0.69 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAAT
AACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTC
AACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAG
CTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)220399 - 618
Exon 4 To Exon 7 (Pair 4)
Forward (379,24)AATTTCAGTTCCACAAATCCAACAAmplicon SizecDNA: 241 bpgenomic: 7,001
Reverse (619,22)CCTTGGAATCTTGAGCTTTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.021 kcal/mol
Forward Dimers-0.959 kcal/mol
Reverse Loops1.318 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceAATTTCAGTTCCACAAATCCAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGG
CTAAAACATGGAGATGTAATAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGT
CTTCAGAATGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCA
CGTCGTGTCTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAG
G
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)241379 - 619
Exon 4 To Exon 7 (Pair 5)
Forward (398,23)CAACACAAGTAAATGGGTCTGTTAmplicon SizecDNA: 221 bpgenomic: 6,981
Reverse (618,23)CTTGGAATCTTGAGCTTTCTCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.432 kcal/mol
Forward Dimers-1.28 kcal/mol
Reverse Loops0.69 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceCAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAA
TAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGT
CAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTA
GCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)221398 - 618
Exon 4 To Exon 7 (Pair 6)
Forward (400,24)ACACAAGTAAATGGGTCTGTTATTAmplicon SizecDNA: 294 bpgenomic: 7,054
Reverse (693,24)ACTGTCTTCTTTGACATTCTTGATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.973 kcal/mol
Forward Dimers-0.739 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.537 kcal/mol outside primersite
Amplicon SequenceACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAATA
ACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTCA
ACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAGC
TTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAATCACTGAA
GGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)294400 - 693
Exon 4 To Exon 7 (Pair 7)
Forward (386,23)GTTCCACAAATCCAACACAAGTAAmplicon SizecDNA: 234 bpgenomic: 6,994
Reverse (619,22)CCTTGGAATCTTGAGCTTTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.92 kcal/mol in 3' area
Forward Dimers-0.29 kcal/mol
Reverse Loops1.318 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceGTTCCACAAATCCAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAAC
ATGGAGATGTAATAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGA
ATGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTG
TCTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)234386 - 619
Exon 4 To Exon 7 (Pair 8)
Forward (459,24)AACTATTATTGATCGTTCCTTCAGAmplicon SizecDNA: 236 bpgenomic: 6,996
Reverse (694,24)TACTGTCTTCTTTGACATTCTTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.96 kcal/mol
Forward Dimers-0.356 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTC
AACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAG
CTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAATCACTGA
AGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)236459 - 694
Exon 4 To Exon 7 (Pair 9)
Forward (459,24)AACTATTATTGATCGTTCCTTCAGAmplicon SizecDNA: 160 bpgenomic: 6,920
Reverse (618,23)CTTGGAATCTTGAGCTTTCTCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.96 kcal/mol
Forward Dimers-0.356 kcal/mol
Reverse Loops0.69 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.768 kcal/mol outside primersite
Amplicon SequenceAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTC
AACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAG
CTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)160459 - 618
Exon 4 To Exon 7 (Pair 10)
Forward (399,24)AACACAAGTAAATGGGTCTGTTATAmplicon SizecDNA: 294 bpgenomic: 7,054
Reverse (692,24)CTGTCTTCTTTGACATTCTTGATANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.432 kcal/mol
Forward Dimers-1.28 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.537 kcal/mol outside primersite
Amplicon SequenceAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAAT
AACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTC
AACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAG
CTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAATCACTGA
AGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)294399 - 692
Exon 4 To Exon 7 (Pair 11)
Forward (378,24)TAATTTCAGTTCCACAAATCCAACAmplicon SizecDNA: 241 bpgenomic: 7,001
Reverse (618,23)CTTGGAATCTTGAGCTTTCTCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.021 kcal/mol
Forward Dimers-0.959 kcal/mol
Reverse Loops0.69 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceTAATTTCAGTTCCACAAATCCAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACG
GCTAAAACATGGAGATGTAATAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAG
TCTTCAGAATGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGC
ACGTCGTGTCTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAA
G
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)241378 - 618
Exon 4 To Exon 7 (Pair 12)
Forward (398,23)CAACACAAGTAAATGGGTCTGTTAmplicon SizecDNA: 296 bpgenomic: 7,056
Reverse (693,24)ACTGTCTTCTTTGACATTCTTGATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.432 kcal/mol
Forward Dimers-1.28 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.537 kcal/mol outside primersite
Amplicon SequenceCAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAA
TAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGT
CAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTA
GCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAATCACTG
AAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)296398 - 693
Exon 4 To Exon 7 (Pair 13)
Forward (386,23)GTTCCACAAATCCAACACAAGTAAmplicon SizecDNA: 233 bpgenomic: 6,993
Reverse (618,23)CTTGGAATCTTGAGCTTTCTCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.92 kcal/mol in 3' area
Forward Dimers-0.29 kcal/mol
Reverse Loops0.69 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceGTTCCACAAATCCAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAAC
ATGGAGATGTAATAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGA
ATGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTG
TCTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)233386 - 618
Exon 4 To Exon 7 (Pair 14)
Forward (459,24)AACTATTATTGATCGTTCCTTCAGAmplicon SizecDNA: 235 bpgenomic: 6,995
Reverse (693,24)ACTGTCTTCTTTGACATTCTTGATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.96 kcal/mol
Forward Dimers-0.356 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTC
AACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAG
CTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAATCACTGA
AGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)235459 - 693
Exon 4 To Exon 7 (Pair 15)
Forward (379,24)AATTTCAGTTCCACAAATCCAACAAmplicon SizecDNA: 240 bpgenomic: 7,000
Reverse (618,23)CTTGGAATCTTGAGCTTTCTCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.021 kcal/mol
Forward Dimers-0.959 kcal/mol
Reverse Loops0.69 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceAATTTCAGTTCCACAAATCCAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGG
CTAAAACATGGAGATGTAATAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGT
CTTCAGAATGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCA
CGTCGTGTCTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)240379 - 618
Exon 4 To Exon 7 (Pair 16)
Forward (398,23)CAACACAAGTAAATGGGTCTGTTAmplicon SizecDNA: 222 bpgenomic: 6,982
Reverse (619,22)CCTTGGAATCTTGAGCTTTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.432 kcal/mol
Forward Dimers-1.28 kcal/mol
Reverse Loops1.318 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceCAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAA
TAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGT
CAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTA
GCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)222398 - 619
Exon 4 To Exon 7 (Pair 17)
Forward (398,23)CAACACAAGTAAATGGGTCTGTTAmplicon SizecDNA: 295 bpgenomic: 7,055
Reverse (692,24)CTGTCTTCTTTGACATTCTTGATANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.432 kcal/mol
Forward Dimers-1.28 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.537 kcal/mol outside primersite
Amplicon SequenceCAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAA
TAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGT
CAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTA
GCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAATCACTG
AAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)295398 - 692
Exon 4 To Exon 7 (Pair 18)
Forward (400,24)ACACAAGTAAATGGGTCTGTTATTAmplicon SizecDNA: 219 bpgenomic: 6,979
Reverse (618,23)CTTGGAATCTTGAGCTTTCTCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.973 kcal/mol
Forward Dimers-0.739 kcal/mol
Reverse Loops0.69 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAATA
ACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTCA
ACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAGC
TTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)219400 - 618
Exon 4 To Exon 7 (Pair 19)
Forward (385,23)AGTTCCACAAATCCAACACAAGTAmplicon SizecDNA: 235 bpgenomic: 6,995
Reverse (619,22)CCTTGGAATCTTGAGCTTTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.362 kcal/mol in 3' area
Forward Dimers-0.617 kcal/mol
Reverse Loops1.318 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceAGTTCCACAAATCCAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAA
CATGGAGATGTAATAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAG
AATGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGT
GTCTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)235385 - 619
Exon 4 To Exon 7 (Pair 20)
Forward (400,24)ACACAAGTAAATGGGTCTGTTATTAmplicon SizecDNA: 293 bpgenomic: 7,053
Reverse (692,24)CTGTCTTCTTTGACATTCTTGATANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.973 kcal/mol
Forward Dimers-0.739 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.537 kcal/mol outside primersite
Amplicon SequenceACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAATA
ACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTCA
ACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAGC
TTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAATCACTGAA
GGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)293400 - 692
Exon 4 To Exon 7 (Pair 21)
Forward (399,24)AACACAAGTAAATGGGTCTGTTATAmplicon SizecDNA: 221 bpgenomic: 6,981
Reverse (619,22)CCTTGGAATCTTGAGCTTTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.432 kcal/mol
Forward Dimers-1.28 kcal/mol
Reverse Loops1.318 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAAT
AACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTC
AACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAG
CTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)221399 - 619
Exon 4 To Exon 7 (Pair 22)
Forward (399,24)AACACAAGTAAATGGGTCTGTTATAmplicon SizecDNA: 296 bpgenomic: 7,056
Reverse (694,24)TACTGTCTTCTTTGACATTCTTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.432 kcal/mol
Forward Dimers-1.28 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.537 kcal/mol outside primersite
Amplicon SequenceAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAAT
AACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTC
AACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAG
CTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAATCACTGA
AGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)296399 - 694
Exon 4 To Exon 7 (Pair 23)
Forward (459,24)AACTATTATTGATCGTTCCTTCAGAmplicon SizecDNA: 161 bpgenomic: 6,921
Reverse (619,22)CCTTGGAATCTTGAGCTTTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.96 kcal/mol
Forward Dimers-0.356 kcal/mol
Reverse Loops1.318 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.768 kcal/mol outside primersite
Amplicon SequenceAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTC
AACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAG
CTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)161459 - 619
Exon 4 To Exon 7 (Pair 24)
Forward (398,23)CAACACAAGTAAATGGGTCTGTTAmplicon SizecDNA: 297 bpgenomic: 7,057
Reverse (694,24)TACTGTCTTCTTTGACATTCTTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.432 kcal/mol
Forward Dimers-1.28 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.537 kcal/mol outside primersite
Amplicon SequenceCAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAA
TAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGT
CAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTA
GCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAATCACTG
AAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)297398 - 694
Exon 4 To Exon 7 (Pair 25)
Forward (400,24)ACACAAGTAAATGGGTCTGTTATTAmplicon SizecDNA: 295 bpgenomic: 7,055
Reverse (694,24)TACTGTCTTCTTTGACATTCTTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.973 kcal/mol
Forward Dimers-0.739 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.537 kcal/mol outside primersite
Amplicon SequenceACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAATA
ACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTCA
ACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAGC
TTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAATCACTGAA
GGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)295400 - 694
Exon 4 To Exon 7 (Pair 26)
Forward (459,24)AACTATTATTGATCGTTCCTTCAGAmplicon SizecDNA: 274 bpgenomic: 7,034
Reverse (732,21)TGTTCCCTGAGCAACACTGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.96 kcal/mol
Forward Dimers-0.356 kcal/mol
Reverse Loops0.855 kcal/mol in 3' area
Reverse Dimers-0.887 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTC
AACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAG
CTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAATCACTGA
AGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAGTACCGC
AGATGACTCAAAAGACAGTGTTGCTCAGGGAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)274459 - 732
Exon 4 To Exon 7 (Pair 27)
Forward (385,23)AGTTCCACAAATCCAACACAAGTAmplicon SizecDNA: 234 bpgenomic: 6,994
Reverse (618,23)CTTGGAATCTTGAGCTTTCTCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.362 kcal/mol in 3' area
Forward Dimers-0.617 kcal/mol
Reverse Loops0.69 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceAGTTCCACAAATCCAACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAA
CATGGAGATGTAATAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAG
AATGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGT
GTCTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)234385 - 618
Exon 4 To Exon 7 (Pair 28)
Forward (400,24)ACACAAGTAAATGGGTCTGTTATTAmplicon SizecDNA: 220 bpgenomic: 6,980
Reverse (619,22)CCTTGGAATCTTGAGCTTTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.973 kcal/mol
Forward Dimers-0.739 kcal/mol
Reverse Loops1.318 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.482 kcal/mol outside primersite
Amplicon SequenceACACAAGTAAATGGGTCTGTTATTGATGAGCCTGTACGGCTAAAACATGGAGATGTAATA
ACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTCA
ACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAGC
TTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)220400 - 619
Exon 4 To Exon 7 (Pair 29)
Forward (459,24)AACTATTATTGATCGTTCCTTCAGAmplicon SizecDNA: 234 bpgenomic: 6,994
Reverse (692,24)CTGTCTTCTTTGACATTCTTGATANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.96 kcal/mol
Forward Dimers-0.356 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceAACTATTATTGATCGTTCCTTCAGGTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTC
AACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAGATCTAG
CTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAATCACTGA
AGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)234459 - 692
Exon 5 To Exon 7 (Pair 1)
Forward (507,23)TGGAAGGAAGTCAACTGAATTTCAmplicon SizecDNA: 186 bpgenomic: 3,385
Reverse (692,24)CTGTCTTCTTTGACATTCTTGATANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGT
CTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTC
AAAAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGA
AGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)186507 - 692
Exon 5 To Exon 7 (Pair 2)
Forward (507,23)TGGAAGGAAGTCAACTGAATTTCAmplicon SizecDNA: 265 bpgenomic: 3,464
Reverse (771,21)GCCATTACGTCCAGCATGTTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.528 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGT
CTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTC
AAAAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGA
AGACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTC
CTCAGAACATGCTGGACGTAATGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)265507 - 771
Exon 5 To Exon 7 (Pair 3)
Forward (511,23)AGGAAGTCAACTGAATTTCCAAGAmplicon SizecDNA: 263 bpgenomic: 3,462
Reverse (773,21)CTGCCATTACGTCCAGCATGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCA
AGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAA
ATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGAC
AGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCA
GAACATGCTGGACGTAATGGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)263511 - 773
Exon 5 To Exon 7 (Pair 4)
Forward (509,23)GAAGGAAGTCAACTGAATTTCCAAmplicon SizecDNA: 261 bpgenomic: 3,460
Reverse (769,22)CATTACGTCCAGCATGTTCTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCT
CAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAA
AAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAG
ACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCT
CAGAACATGCTGGACGTAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)261509 - 769
Exon 5 To Exon 7 (Pair 5)
Forward (512,23)GGAAGTCAACTGAATTTCCAAGAAmplicon SizecDNA: 266 bpgenomic: 3,465
Reverse (777,22)ATTTCTGCCATTACGTCCAGCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAA
GATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAA
TCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACA
GTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAG
AACATGCTGGACGTAATGGCAGAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)266512 - 777
Exon 5 To Exon 7 (Pair 6)
Forward (512,23)GGAAGTCAACTGAATTTCCAAGAAmplicon SizecDNA: 107 bpgenomic: 3,306
Reverse (618,23)CTTGGAATCTTGAGCTTTCTCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops0.69 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.768 kcal/mol outside primersite
Amplicon SequenceGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAA
GATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)107512 - 618
Exon 5 To Exon 7 (Pair 7)
Forward (511,23)AGGAAGTCAACTGAATTTCCAAGAmplicon SizecDNA: 256 bpgenomic: 3,455
Reverse (766,21)TACGTCCAGCATGTTCTGAGGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCA
AGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAA
ATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGAC
AGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCA
GAACATGCTGGACGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)256511 - 766
Exon 5 To Exon 7 (Pair 8)
Forward (511,23)AGGAAGTCAACTGAATTTCCAAGAmplicon SizecDNA: 184 bpgenomic: 3,383
Reverse (694,24)TACTGTCTTCTTTGACATTCTTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCA
AGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAA
ATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGAC
AGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)184511 - 694
Exon 5 To Exon 7 (Pair 9)
Forward (511,23)AGGAAGTCAACTGAATTTCCAAGAmplicon SizecDNA: 261 bpgenomic: 3,460
Reverse (771,21)GCCATTACGTCCAGCATGTTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.528 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCA
AGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAA
ATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGAC
AGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCA
GAACATGCTGGACGTAATGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)261511 - 771
Exon 5 To Exon 7 (Pair 10)
Forward (507,23)TGGAAGGAAGTCAACTGAATTTCAmplicon SizecDNA: 226 bpgenomic: 3,425
Reverse (732,21)TGTTCCCTGAGCAACACTGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops0.855 kcal/mol in 3' area
Reverse Dimers-0.887 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGT
CTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTC
AAAAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGA
AGACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)226507 - 732
Exon 5 To Exon 7 (Pair 11)
Forward (507,23)TGGAAGGAAGTCAACTGAATTTCAmplicon SizecDNA: 259 bpgenomic: 3,458
Reverse (765,21)ACGTCCAGCATGTTCTGAGGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-1.95 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGT
CTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTC
AAAAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGA
AGACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTC
CTCAGAACATGCTGGACGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)259507 - 765
Exon 5 To Exon 7 (Pair 12)
Forward (513,24)GAAGTCAACTGAATTTCCAAGAAAAmplicon SizecDNA: 220 bpgenomic: 3,419
Reverse (732,21)TGTTCCCTGAGCAACACTGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops0.855 kcal/mol in 3' area
Reverse Dimers-0.887 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAG
ATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAAT
CACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
TACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)220513 - 732
Exon 5 To Exon 7 (Pair 13)
Forward (513,24)GAAGTCAACTGAATTTCCAAGAAAAmplicon SizecDNA: 182 bpgenomic: 3,381
Reverse (694,24)TACTGTCTTCTTTGACATTCTTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAG
ATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAAT
CACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
TA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)182513 - 694
Exon 5 To Exon 7 (Pair 14)
Forward (513,24)GAAGTCAACTGAATTTCCAAGAAAAmplicon SizecDNA: 180 bpgenomic: 3,379
Reverse (692,24)CTGTCTTCTTTGACATTCTTGATANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAG
ATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAAT
CACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)180513 - 692
Exon 5 To Exon 7 (Pair 15)
Forward (512,23)GGAAGTCAACTGAATTTCCAAGAAmplicon SizecDNA: 182 bpgenomic: 3,381
Reverse (693,24)ACTGTCTTCTTTGACATTCTTGATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAA
GATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAA
TCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACA
GT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)182512 - 693
Exon 5 To Exon 7 (Pair 16)
Forward (513,24)GAAGTCAACTGAATTTCCAAGAAAAmplicon SizecDNA: 265 bpgenomic: 3,464
Reverse (777,22)ATTTCTGCCATTACGTCCAGCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAG
ATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAAT
CACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
TACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAGA
ACATGCTGGACGTAATGGCAGAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)265513 - 777
Exon 5 To Exon 7 (Pair 17)
Forward (513,24)GAAGTCAACTGAATTTCCAAGAAAAmplicon SizecDNA: 253 bpgenomic: 3,452
Reverse (765,21)ACGTCCAGCATGTTCTGAGGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-1.95 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAG
ATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAAT
CACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
TACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAGA
ACATGCTGGACGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)253513 - 765
Exon 5 To Exon 7 (Pair 18)
Forward (513,24)GAAGTCAACTGAATTTCCAAGAAAAmplicon SizecDNA: 106 bpgenomic: 3,305
Reverse (618,23)CTTGGAATCTTGAGCTTTCTCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops0.69 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.768 kcal/mol outside primersite
Amplicon SequenceGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAG
ATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)106513 - 618
Exon 5 To Exon 7 (Pair 19)
Forward (512,23)GGAAGTCAACTGAATTTCCAAGAAmplicon SizecDNA: 181 bpgenomic: 3,380
Reverse (692,24)CTGTCTTCTTTGACATTCTTGATANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAA
GATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAA
TCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACA
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)181512 - 692
Exon 5 To Exon 7 (Pair 20)
Forward (511,23)AGGAAGTCAACTGAATTTCCAAGAmplicon SizecDNA: 183 bpgenomic: 3,382
Reverse (693,24)ACTGTCTTCTTTGACATTCTTGATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCA
AGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAA
ATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGAC
AGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)183511 - 693
Exon 5 To Exon 7 (Pair 21)
Forward (507,23)TGGAAGGAAGTCAACTGAATTTCAmplicon SizecDNA: 112 bpgenomic: 3,311
Reverse (618,23)CTTGGAATCTTGAGCTTTCTCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops0.69 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.768 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGT
CTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)112507 - 618
Exon 5 To Exon 7 (Pair 22)
Forward (512,23)GGAAGTCAACTGAATTTCCAAGAAmplicon SizecDNA: 221 bpgenomic: 3,420
Reverse (732,21)TGTTCCCTGAGCAACACTGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops0.855 kcal/mol in 3' area
Reverse Dimers-0.887 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAA
GATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAA
TCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACA
GTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)221512 - 732
Exon 5 To Exon 7 (Pair 23)
Forward (507,23)TGGAAGGAAGTCAACTGAATTTCAmplicon SizecDNA: 258 bpgenomic: 3,457
Reverse (764,21)CGTCCAGCATGTTCTGAGGAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol
Reverse Dimers-0.848 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGT
CTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTC
AAAAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGA
AGACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTC
CTCAGAACATGCTGGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)258507 - 764
Exon 5 To Exon 7 (Pair 24)
Forward (509,23)GAAGGAAGTCAACTGAATTTCCAAmplicon SizecDNA: 110 bpgenomic: 3,309
Reverse (618,23)CTTGGAATCTTGAGCTTTCTCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops0.69 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.768 kcal/mol outside primersite
Amplicon SequenceGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCT
CAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)110509 - 618
Exon 5 To Exon 7 (Pair 25)
Forward (513,24)GAAGTCAACTGAATTTCCAAGAAAAmplicon SizecDNA: 257 bpgenomic: 3,456
Reverse (769,22)CATTACGTCCAGCATGTTCTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAG
ATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAAT
CACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
TACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAGA
ACATGCTGGACGTAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)257513 - 769
Exon 5 To Exon 7 (Pair 26)
Forward (507,23)TGGAAGGAAGTCAACTGAATTTCAmplicon SizecDNA: 188 bpgenomic: 3,387
Reverse (694,24)TACTGTCTTCTTTGACATTCTTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGT
CTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTC
AAAAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGA
AGACAGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)188507 - 694
Exon 5 To Exon 7 (Pair 27)
Forward (512,23)GGAAGTCAACTGAATTTCCAAGAAmplicon SizecDNA: 257 bpgenomic: 3,456
Reverse (768,22)ATTACGTCCAGCATGTTCTGAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAA
GATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAA
TCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACA
GTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAG
AACATGCTGGACGTAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)257512 - 768
Exon 5 To Exon 7 (Pair 28)
Forward (509,23)GAAGGAAGTCAACTGAATTTCCAAmplicon SizecDNA: 266 bpgenomic: 3,465
Reverse (774,21)TCTGCCATTACGTCCAGCATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCT
CAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAA
AAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAG
ACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCT
CAGAACATGCTGGACGTAATGGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)266509 - 774
Exon 5 To Exon 7 (Pair 29)
Forward (512,23)GGAAGTCAACTGAATTTCCAAGAAmplicon SizecDNA: 183 bpgenomic: 3,382
Reverse (694,24)TACTGTCTTCTTTGACATTCTTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAA
GATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAA
TCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACA
GTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)183512 - 694
Exon 5 To Exon 7 (Pair 30)
Forward (507,23)TGGAAGGAAGTCAACTGAATTTCAmplicon SizecDNA: 263 bpgenomic: 3,462
Reverse (769,22)CATTACGTCCAGCATGTTCTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGT
CTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTC
AAAAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGA
AGACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTC
CTCAGAACATGCTGGACGTAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)263507 - 769
Exon 5 To Exon 7 (Pair 31)
Forward (511,23)AGGAAGTCAACTGAATTTCCAAGAmplicon SizecDNA: 254 bpgenomic: 3,453
Reverse (764,21)CGTCCAGCATGTTCTGAGGAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol
Reverse Dimers-0.848 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCA
AGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAA
ATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGAC
AGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCA
GAACATGCTGGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)254511 - 764
Exon 5 To Exon 7 (Pair 32)
Forward (512,23)GGAAGTCAACTGAATTTCCAAGAAmplicon SizecDNA: 255 bpgenomic: 3,454
Reverse (766,21)TACGTCCAGCATGTTCTGAGGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAA
GATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAA
TCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACA
GTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAG
AACATGCTGGACGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)255512 - 766
Exon 5 To Exon 7 (Pair 33)
Forward (509,23)GAAGGAAGTCAACTGAATTTCCAAmplicon SizecDNA: 185 bpgenomic: 3,384
Reverse (693,24)ACTGTCTTCTTTGACATTCTTGATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCT
CAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAA
AAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAG
ACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)185509 - 693
Exon 5 To Exon 7 (Pair 34)
Forward (507,23)TGGAAGGAAGTCAACTGAATTTCAmplicon SizecDNA: 260 bpgenomic: 3,459
Reverse (766,21)TACGTCCAGCATGTTCTGAGGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGT
CTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTC
AAAAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGA
AGACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTC
CTCAGAACATGCTGGACGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)260507 - 766
Exon 5 To Exon 7 (Pair 35)
Forward (511,23)AGGAAGTCAACTGAATTTCCAAGAmplicon SizecDNA: 108 bpgenomic: 3,307
Reverse (618,23)CTTGGAATCTTGAGCTTTCTCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops0.69 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.768 kcal/mol outside primersite
Amplicon SequenceAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCA
AGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)108511 - 618
Exon 5 To Exon 7 (Pair 36)
Forward (509,23)GAAGGAAGTCAACTGAATTTCCAAmplicon SizecDNA: 258 bpgenomic: 3,457
Reverse (766,21)TACGTCCAGCATGTTCTGAGGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCT
CAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAA
AAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAG
ACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCT
CAGAACATGCTGGACGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)258509 - 766
Exon 5 To Exon 7 (Pair 37)
Forward (509,23)GAAGGAAGTCAACTGAATTTCCAAmplicon SizecDNA: 257 bpgenomic: 3,456
Reverse (765,21)ACGTCCAGCATGTTCTGAGGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-1.95 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCT
CAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAA
AAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAG
ACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCT
CAGAACATGCTGGACGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)257509 - 765
Exon 5 To Exon 7 (Pair 38)
Forward (513,24)GAAGTCAACTGAATTTCCAAGAAAAmplicon SizecDNA: 264 bpgenomic: 3,463
Reverse (776,22)TTTCTGCCATTACGTCCAGCATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAG
ATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAAT
CACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
TACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAGA
ACATGCTGGACGTAATGGCAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)264513 - 776
Exon 5 To Exon 7 (Pair 39)
Forward (509,23)GAAGGAAGTCAACTGAATTTCCAAmplicon SizecDNA: 186 bpgenomic: 3,385
Reverse (694,24)TACTGTCTTCTTTGACATTCTTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCT
CAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAA
AAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAG
ACAGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)186509 - 694
Exon 5 To Exon 7 (Pair 40)
Forward (507,23)TGGAAGGAAGTCAACTGAATTTCAmplicon SizecDNA: 271 bpgenomic: 3,470
Reverse (777,22)ATTTCTGCCATTACGTCCAGCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGT
CTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTC
AAAAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGA
AGACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTC
CTCAGAACATGCTGGACGTAATGGCAGAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)271507 - 777
Exon 5 To Exon 7 (Pair 41)
Forward (511,23)AGGAAGTCAACTGAATTTCCAAGAmplicon SizecDNA: 266 bpgenomic: 3,465
Reverse (776,22)TTTCTGCCATTACGTCCAGCATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCA
AGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAA
ATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGAC
AGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCA
GAACATGCTGGACGTAATGGCAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)266511 - 776
Exon 5 To Exon 7 (Pair 42)
Forward (513,24)GAAGTCAACTGAATTTCCAAGAAAAmplicon SizecDNA: 262 bpgenomic: 3,461
Reverse (774,21)TCTGCCATTACGTCCAGCATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAG
ATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAAT
CACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
TACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAGA
ACATGCTGGACGTAATGGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)262513 - 774
Exon 5 To Exon 7 (Pair 43)
Forward (509,23)GAAGGAAGTCAACTGAATTTCCAAmplicon SizecDNA: 224 bpgenomic: 3,423
Reverse (732,21)TGTTCCCTGAGCAACACTGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops0.855 kcal/mol in 3' area
Reverse Dimers-0.887 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCT
CAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAA
AAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAG
ACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)224509 - 732
Exon 5 To Exon 7 (Pair 44)
Forward (513,24)GAAGTCAACTGAATTTCCAAGAAAAmplicon SizecDNA: 181 bpgenomic: 3,380
Reverse (693,24)ACTGTCTTCTTTGACATTCTTGATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAG
ATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAAT
CACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)181513 - 693
Exon 5 To Exon 7 (Pair 45)
Forward (511,23)AGGAAGTCAACTGAATTTCCAAGAmplicon SizecDNA: 267 bpgenomic: 3,466
Reverse (777,22)ATTTCTGCCATTACGTCCAGCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCA
AGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAA
ATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGAC
AGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCA
GAACATGCTGGACGTAATGGCAGAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)267511 - 777
Exon 5 To Exon 7 (Pair 46)
Forward (511,23)AGGAAGTCAACTGAATTTCCAAGAmplicon SizecDNA: 255 bpgenomic: 3,454
Reverse (765,21)ACGTCCAGCATGTTCTGAGGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-1.95 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCA
AGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAA
ATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGAC
AGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCA
GAACATGCTGGACGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)255511 - 765
Exon 5 To Exon 7 (Pair 47)
Forward (512,23)GGAAGTCAACTGAATTTCCAAGAAmplicon SizecDNA: 260 bpgenomic: 3,459
Reverse (771,21)GCCATTACGTCCAGCATGTTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.528 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAA
GATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAA
TCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACA
GTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAG
AACATGCTGGACGTAATGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)260512 - 771
Exon 5 To Exon 7 (Pair 48)
Forward (512,23)GGAAGTCAACTGAATTTCCAAGAAmplicon SizecDNA: 108 bpgenomic: 3,307
Reverse (619,22)CCTTGGAATCTTGAGCTTTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.318 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.768 kcal/mol outside primersite
Amplicon SequenceGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAA
GATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)108512 - 619
Exon 5 To Exon 7 (Pair 49)
Forward (512,23)GGAAGTCAACTGAATTTCCAAGAAmplicon SizecDNA: 262 bpgenomic: 3,461
Reverse (773,21)CTGCCATTACGTCCAGCATGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAA
GATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAA
TCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACA
GTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAG
AACATGCTGGACGTAATGGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)262512 - 773
Exon 5 To Exon 7 (Pair 50)
Forward (509,23)GAAGGAAGTCAACTGAATTTCCAAmplicon SizecDNA: 260 bpgenomic: 3,459
Reverse (768,22)ATTACGTCCAGCATGTTCTGAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCT
CAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAA
AAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAG
ACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCT
CAGAACATGCTGGACGTAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)260509 - 768
Exon 5 To Exon 7 (Pair 51)
Forward (509,23)GAAGGAAGTCAACTGAATTTCCAAmplicon SizecDNA: 269 bpgenomic: 3,468
Reverse (777,22)ATTTCTGCCATTACGTCCAGCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCT
CAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAA
AAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAG
ACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCT
CAGAACATGCTGGACGTAATGGCAGAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)269509 - 777
Exon 5 To Exon 7 (Pair 52)
Forward (511,23)AGGAAGTCAACTGAATTTCCAAGAmplicon SizecDNA: 258 bpgenomic: 3,457
Reverse (768,22)ATTACGTCCAGCATGTTCTGAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCA
AGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAA
ATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGAC
AGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCA
GAACATGCTGGACGTAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)258511 - 768
Exon 5 To Exon 7 (Pair 53)
Forward (513,24)GAAGTCAACTGAATTTCCAAGAAAAmplicon SizecDNA: 259 bpgenomic: 3,458
Reverse (771,21)GCCATTACGTCCAGCATGTTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.528 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAG
ATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAAT
CACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
TACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAGA
ACATGCTGGACGTAATGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)259513 - 771
Exon 5 To Exon 7 (Pair 54)
Forward (512,23)GGAAGTCAACTGAATTTCCAAGAAmplicon SizecDNA: 258 bpgenomic: 3,457
Reverse (769,22)CATTACGTCCAGCATGTTCTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAA
GATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAA
TCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACA
GTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAG
AACATGCTGGACGTAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)258512 - 769
Exon 5 To Exon 7 (Pair 55)
Forward (511,23)AGGAAGTCAACTGAATTTCCAAGAmplicon SizecDNA: 222 bpgenomic: 3,421
Reverse (732,21)TGTTCCCTGAGCAACACTGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops0.855 kcal/mol in 3' area
Reverse Dimers-0.887 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCA
AGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAA
ATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGAC
AGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)222511 - 732
Exon 5 To Exon 7 (Pair 56)
Forward (509,23)GAAGGAAGTCAACTGAATTTCCAAmplicon SizecDNA: 111 bpgenomic: 3,310
Reverse (619,22)CCTTGGAATCTTGAGCTTTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.318 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.768 kcal/mol outside primersite
Amplicon SequenceGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCT
CAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)111509 - 619
Exon 5 To Exon 7 (Pair 57)
Forward (513,24)GAAGTCAACTGAATTTCCAAGAAAAmplicon SizecDNA: 252 bpgenomic: 3,451
Reverse (764,21)CGTCCAGCATGTTCTGAGGAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol
Reverse Dimers-0.848 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAG
ATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAAT
CACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
TACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAGA
ACATGCTGGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)252513 - 764
Exon 5 To Exon 7 (Pair 58)
Forward (511,23)AGGAAGTCAACTGAATTTCCAAGAmplicon SizecDNA: 264 bpgenomic: 3,463
Reverse (774,21)TCTGCCATTACGTCCAGCATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCA
AGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAA
ATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGAC
AGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCA
GAACATGCTGGACGTAATGGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)264511 - 774
Exon 5 To Exon 7 (Pair 59)
Forward (512,23)GGAAGTCAACTGAATTTCCAAGAAmplicon SizecDNA: 253 bpgenomic: 3,452
Reverse (764,21)CGTCCAGCATGTTCTGAGGAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol
Reverse Dimers-0.848 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAA
GATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAA
TCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACA
GTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAG
AACATGCTGGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)253512 - 764
Exon 5 To Exon 7 (Pair 60)
Forward (513,24)GAAGTCAACTGAATTTCCAAGAAAAmplicon SizecDNA: 261 bpgenomic: 3,460
Reverse (773,21)CTGCCATTACGTCCAGCATGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAG
ATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAAT
CACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
TACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAGA
ACATGCTGGACGTAATGGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)261513 - 773
Exon 5 To Exon 7 (Pair 61)
Forward (513,24)GAAGTCAACTGAATTTCCAAGAAAAmplicon SizecDNA: 256 bpgenomic: 3,455
Reverse (768,22)ATTACGTCCAGCATGTTCTGAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAG
ATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAAT
CACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAG
TACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAGA
ACATGCTGGACGTAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)256513 - 768
Exon 5 To Exon 7 (Pair 62)
Forward (507,23)TGGAAGGAAGTCAACTGAATTTCAmplicon SizecDNA: 268 bpgenomic: 3,467
Reverse (774,21)TCTGCCATTACGTCCAGCATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGT
CTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTC
AAAAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGA
AGACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTC
CTCAGAACATGCTGGACGTAATGGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)268507 - 774
Exon 5 To Exon 7 (Pair 63)
Forward (509,23)GAAGGAAGTCAACTGAATTTCCAAmplicon SizecDNA: 256 bpgenomic: 3,455
Reverse (764,21)CGTCCAGCATGTTCTGAGGAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol
Reverse Dimers-0.848 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCT
CAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAA
AAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAG
ACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCT
CAGAACATGCTGGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)256509 - 764
Exon 5 To Exon 7 (Pair 64)
Forward (511,23)AGGAAGTCAACTGAATTTCCAAGAmplicon SizecDNA: 259 bpgenomic: 3,458
Reverse (769,22)CATTACGTCCAGCATGTTCTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.13 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCA
AGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAA
ATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGAC
AGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCA
GAACATGCTGGACGTAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)259511 - 769
Exon 5 To Exon 7 (Pair 65)
Forward (507,23)TGGAAGGAAGTCAACTGAATTTCAmplicon SizecDNA: 187 bpgenomic: 3,386
Reverse (693,24)ACTGTCTTCTTTGACATTCTTGATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.104 kcal/mol
Reverse Dimers-0.505 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.823 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGT
CTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTC
AAAAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGA
AGACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)187507 - 693
Exon 5 To Exon 7 (Pair 66)
Forward (512,23)GGAAGTCAACTGAATTTCCAAGAAmplicon SizecDNA: 263 bpgenomic: 3,462
Reverse (774,21)TCTGCCATTACGTCCAGCATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAA
GATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAA
TCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAGACA
GTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAG
AACATGCTGGACGTAATGGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)263512 - 774
Exon 5 To Exon 7 (Pair 67)
Forward (507,23)TGGAAGGAAGTCAACTGAATTTCAmplicon SizecDNA: 270 bpgenomic: 3,469
Reverse (776,22)TTTCTGCCATTACGTCCAGCATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGT
CTCAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTC
AAAAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGA
AGACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTC
CTCAGAACATGCTGGACGTAATGGCAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)270507 - 776
Exon 5 To Exon 7 (Pair 68)
Forward (513,24)GAAGTCAACTGAATTTCCAAGAAAAmplicon SizecDNA: 107 bpgenomic: 3,306
Reverse (619,22)CCTTGGAATCTTGAGCTTTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops1.318 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.768 kcal/mol outside primersite
Amplicon SequenceGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCTCAAG
ATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002417 (MKI67)107513 - 619
Exon 5 To Exon 7 (Pair 69)
Forward (509,23)GAAGGAAGTCAACTGAATTTCCAAmplicon SizecDNA: 265 bpgenomic: 3,464
Reverse (773,21)CTGCCATTACGTCCAGCATGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.118 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops1.416 kcal/mol in 3' area
Reverse Dimers-2.408 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.461 kcal/mol outside primersite
Amplicon SequenceGAAGGAAGTCAACTGAATTTCCAAGAAAAATACGTGAACAGGAGCCAGCACGTCGTGTCT
CAAGATCTAGCTTCTCTTCTGACCCTGATGAGAAAGCTCAAGATTCCAAGGCCTATTCAA
AAATCACTGAAGGAAAAGTTTCAGGAAATCCTCAGGTACATATCAAGAATGTCAAAGAAG
ACAGTACCGCAGATGACTCAAAAGACAGTGTTGCTCAGGGAACAACTAATGTTCATTCCT
CAGAACATGCTGGACGTAATGGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002417 (MKI67)265509 - 773
 

See below for some more details.

Program Output:

Loading ...