Design Results for mmp13

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size400
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding-2
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 7 To Exon 10 (Pair 1)
Forward (1012,22)CAGAACTTCCCAACCGTATTGAAmplicon SizecDNA: 380 bpgenomic: 4,774
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.713 kcal/mol in 3' area
Forward Dimers-0.646 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-0.997 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCA
TCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCA
AAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACT
TTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATA
CTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTG
GTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCA
TACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3801012 - 1391
Exon 7 To Exon 10 (Pair 2)
Forward (1009,20)GGCCAGAACTTCCCAACCGTAmplicon SizecDNA: 383 bpgenomic: 4,777
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.131 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceGGCCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCT
TCATCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATC
CCAAAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTC
ACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATG
ATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAA
TTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGAC
CCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3831009 - 1391
Exon 7 To Exon 10 (Pair 3)
Forward (1010,21)GCCAGAACTTCCCAACCGTATAmplicon SizecDNA: 382 bpgenomic: 4,776
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.131 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceGCCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTT
CATCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCC
CAAAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCA
CTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGA
TACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAAT
TGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACC
CATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3821010 - 1391
Exon 7 To Exon 10 (Pair 4)
Forward (1019,21)TCCCAACCGTATTGATGCTGCAmplicon SizecDNA: 373 bpgenomic: 4,767
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.713 kcal/mol
Forward Dimers-0.692 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-0.834 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAG
AGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAAT
ATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGA
TACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCA
TATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAA
AGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTT
TGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3731019 - 1391
Exon 7 To Exon 10 (Pair 5)
Forward (1036,21)CTGCATATGAGCACCCTTCTCAmplicon SizecDNA: 356 bpgenomic: 4,750
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.775 kcal/mol
Forward Dimers-2.37 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.688 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTGGG
CTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCTTC
CAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCC
TGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACT
ATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATG
AGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3561036 - 1391
Exon 7 To Exon 10 (Pair 6)
Forward (1035,21)GCTGCATATGAGCACCCTTCTAmplicon SizecDNA: 357 bpgenomic: 4,751
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.775 kcal/mol
Forward Dimers-2.37 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.688 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTGG
GCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCTT
CCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTC
CTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGAC
TATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTAT
GAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3571035 - 1391
Exon 7 To Exon 10 (Pair 7)
Forward (1034,21)TGCTGCATATGAGCACCCTTCAmplicon SizecDNA: 358 bpgenomic: 4,752
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.775 kcal/mol
Forward Dimers-2.37 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.688 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceTGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTG
GGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCT
TCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCT
CCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGA
CTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTA
TGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3581034 - 1391
Exon 7 To Exon 10 (Pair 8)
Forward (1015,22)AACTTCCCAACCGTATTGATGCAmplicon SizecDNA: 377 bpgenomic: 4,771
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.713 kcal/mol in 3' area
Forward Dimers-0.237 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-0.834 kcal/mol in 3' area
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCT
TCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAA
AAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTG
AGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTA
ACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTG
ATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATAC
AGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3771015 - 1391
Exon 7 To Exon 10 (Pair 9)
Forward (1016,22)ACTTCCCAACCGTATTGATGCTAmplicon SizecDNA: 376 bpgenomic: 4,770
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.713 kcal/mol
Forward Dimers-0.237 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-0.834 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTT
CAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAA
AATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGA
GGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAA
CCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGA
TAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACA
GTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3761016 - 1391
Exon 7 To Exon 10 (Pair 10)
Forward (1014,22)GAACTTCCCAACCGTATTGATGAmplicon SizecDNA: 378 bpgenomic: 4,772
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.713 kcal/mol in 3' area
Forward Dimers-0.237 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-0.834 kcal/mol in 3' area
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATC
TTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAA
AAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTT
GAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACT
AACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGT
GATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATA
CAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3781014 - 1391
Exon 7 To Exon 10 (Pair 11)
Forward (1037,22)TGCATATGAGCACCCTTCTCATAmplicon SizecDNA: 355 bpgenomic: 4,749
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.775 kcal/mol
Forward Dimers-2.37 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.688 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTGGGC
TCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCTTCC
AAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCT
GTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTA
TCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGA
GAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3551037 - 1391
Exon 8 To Exon 10 (Pair 1)
Forward (1203,21)GGCAAGACTCTCCTGTTCTCAAmplicon SizecDNA: 189 bpgenomic: 3,609
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.351 kcal/mol
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATT
ATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTA
GATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAA
TACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1891203 - 1391
Exon 8 To Exon 10 (Pair 2)
Forward (1204,21)GCAAGACTCTCCTGTTCTCAGAmplicon SizecDNA: 188 bpgenomic: 3,608
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.397 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.064 kcal/mol
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTA
TGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAG
ATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAAT
ACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1881204 - 1391
Exon 8 To Exon 10 (Pair 3)
Forward (1212,21)CTCCTGTTCTCAGGAAACCAGAmplicon SizecDNA: 180 bpgenomic: 3,600
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops-0.848 kcal/mol
Forward Dimers-1.877 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.086 kcal/mol in 3' area
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAA
GACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTC
TATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1801212 - 1391
Exon 8 To Exon 10 (Pair 4)
Forward (1159,24)AAGAAGTTAAGAAGATAAGTGCAGAmplicon SizecDNA: 332 bpgenomic: 3,752
Reverse (1490,23)CCCAAATGCTCTTCAGGATTTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.131 kcal/mol
Forward Dimers-1.072 kcal/mol in 3' area
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.911 kcal/mol in 3' area
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGT
TCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATC
CGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGA
AAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTA
ACCGTATTGTTCGCGTCATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAA
AATTGTTATTTAAATCCTGAAGAGCATTTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3321159 - 1490
Exon 8 To Exon 10 (Pair 5)
Forward (1207,22)AGACTCTCCTGTTCTCAGGAAAAmplicon SizecDNA: 185 bpgenomic: 3,605
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops-0.848 kcal/mol in 3' area
Forward Dimers-1.877 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-0.816 kcal/mol
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGG
ATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATG
CTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACA
GCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1851207 - 1391
Exon 8 To Exon 10 (Pair 6)
Forward (1213,21)TCCTGTTCTCAGGAAACCAGGAmplicon SizecDNA: 179 bpgenomic: 3,599
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops-0.848 kcal/mol
Forward Dimers-1.877 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.086 kcal/mol in 3' area
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAG
ACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCT
ATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1791213 - 1391
Exon 8 To Exon 10 (Pair 7)
Forward (1159,24)AAGAAGTTAAGAAGATAAGTGCAGAmplicon SizecDNA: 331 bpgenomic: 3,751
Reverse (1489,24)CCAAATGCTCTTCAGGATTTAAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.131 kcal/mol
Forward Dimers-1.072 kcal/mol in 3' area
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.911 kcal/mol in 3' area
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGT
TCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATC
CGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGA
AAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTA
ACCGTATTGTTCGCGTCATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAA
AATTGTTATTTAAATCCTGAAGAGCATTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3311159 - 1489
Exon 8 To Exon 10 (Pair 8)
Forward (1161,23)GAAGTTAAGAAGATAAGTGCAGCAmplicon SizecDNA: 329 bpgenomic: 3,749
Reverse (1489,24)CCAAATGCTCTTCAGGATTTAAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.585 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol in 3' area
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.911 kcal/mol in 3' area
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTC
TCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCG
AGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAA
AATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAAC
CGTATTGTTCGCGTCATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAAAA
TTGTTATTTAAATCCTGAAGAGCATTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3291161 - 1489
Exon 8 To Exon 10 (Pair 9)
Forward (1159,24)AAGAAGTTAAGAAGATAAGTGCAGAmplicon SizecDNA: 233 bpgenomic: 3,653
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.131 kcal/mol
Forward Dimers-1.072 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.128 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGT
TCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATC
CGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGA
AAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)2331159 - 1391
Exon 8 To Exon 10 (Pair 10)
Forward (1206,22)AAGACTCTCCTGTTCTCAGGAAAmplicon SizecDNA: 186 bpgenomic: 3,606
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops-0.848 kcal/mol in 3' area
Forward Dimers-1.877 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.064 kcal/mol
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATG
GATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGAT
GCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATAC
AGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1861206 - 1391
Exon 8 To Exon 10 (Pair 11)
Forward (1210,21)CTCTCCTGTTCTCAGGAAACCAmplicon SizecDNA: 182 bpgenomic: 3,602
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops-0.848 kcal/mol
Forward Dimers-1.877 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-0.816 kcal/mol
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceCTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATA
AAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTG
TCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCA
TC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1821210 - 1391
Exon 8 To Exon 10 (Pair 12)
Forward (1205,21)CAAGACTCTCCTGTTCTCAGGAmplicon SizecDNA: 187 bpgenomic: 3,607
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops-0.037 kcal/mol in 3' area
Forward Dimers-1.066 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.064 kcal/mol
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTAT
GGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGA
TGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATA
CAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1871205 - 1391
Exon 8 To Exon 10 (Pair 13)
Forward (1161,23)GAAGTTAAGAAGATAAGTGCAGCAmplicon SizecDNA: 231 bpgenomic: 3,651
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.585 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.128 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTC
TCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCG
AGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAA
AATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)2311161 - 1391
Exon 8 To Exon 10 (Pair 14)
Forward (1161,23)GAAGTTAAGAAGATAAGTGCAGCAmplicon SizecDNA: 330 bpgenomic: 3,750
Reverse (1490,23)CCCAAATGCTCTTCAGGATTTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.585 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol in 3' area
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.911 kcal/mol in 3' area
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTC
TCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCG
AGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAA
AATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAAC
CGTATTGTTCGCGTCATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAAAA
TTGTTATTTAAATCCTGAAGAGCATTTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3301161 - 1490
 

See below for some more details.

Program Output:

Loading ...