Design Results for mmp13

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size400
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding-2
Minimal dG for primer dimer-4 Minimal dG for amplicon folding-4
Nr of bases considered as 3'5Minimal Intron Size0

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 7 To Exon 10 (Pair 1)
Forward (1019,21)TCCCAACCGTATTGATGCTGCAmplicon SizecDNA: 373 bpgenomic: 4,767
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.713 kcal/mol
Forward Dimers-0.692 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-0.834 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAG
AGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAAT
ATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGA
TACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCA
TATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAA
AGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTT
TGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3731019 - 1391
Exon 7 To Exon 10 (Pair 2)
Forward (1036,21)CTGCATATGAGCACCCTTCTCAmplicon SizecDNA: 356 bpgenomic: 4,750
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.775 kcal/mol
Forward Dimers-2.37 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.688 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTGGG
CTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCTTC
CAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCC
TGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACT
ATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATG
AGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3561036 - 1391
Exon 7 To Exon 10 (Pair 3)
Forward (1034,21)TGCTGCATATGAGCACCCTTCAmplicon SizecDNA: 358 bpgenomic: 4,752
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.775 kcal/mol
Forward Dimers-2.37 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.688 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceTGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTG
GGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCT
TCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCT
CCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGA
CTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTA
TGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3581034 - 1391
Exon 7 To Exon 10 (Pair 4)
Forward (1006,21)TTTGGCCAGAACTTCCCAACCAmplicon SizecDNA: 386 bpgenomic: 4,780
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.285 kcal/mol in 3' area
Forward Dimers-3.894 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceTTTGGCCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCA
TCTTCATCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTT
ATCCCAAAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTG
TTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATG
ATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAG
GAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACG
GACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3861006 - 1391
Exon 7 To Exon 10 (Pair 5)
Forward (1009,20)GGCCAGAACTTCCCAACCGTAmplicon SizecDNA: 383 bpgenomic: 4,777
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.131 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceGGCCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCT
TCATCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATC
CCAAAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTC
ACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATG
ATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAA
TTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGAC
CCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3831009 - 1391
Exon 7 To Exon 10 (Pair 6)
Forward (1010,21)GCCAGAACTTCCCAACCGTATAmplicon SizecDNA: 382 bpgenomic: 4,776
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.131 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceGCCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTT
CATCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCC
CAAAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCA
CTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGA
TACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAAT
TGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACC
CATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3821010 - 1391
Exon 7 To Exon 10 (Pair 7)
Forward (1037,22)TGCATATGAGCACCCTTCTCATAmplicon SizecDNA: 355 bpgenomic: 4,749
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.775 kcal/mol
Forward Dimers-2.37 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.688 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTGGGC
TCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCTTCC
AAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCT
GTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTA
TCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGA
GAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3551037 - 1391
Exon 7 To Exon 10 (Pair 8)
Forward (1008,20)TGGCCAGAACTTCCCAACCGAmplicon SizecDNA: 384 bpgenomic: 4,778
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.757 kcal/mol in 3' area
Forward Dimers-3.752 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceTGGCCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATC
TTCATCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTAT
CCCAAAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTT
CACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGAT
GATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGA
ATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGA
CCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3841008 - 1391
Exon 7 To Exon 10 (Pair 9)
Forward (1035,21)GCTGCATATGAGCACCCTTCTAmplicon SizecDNA: 357 bpgenomic: 4,751
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.775 kcal/mol
Forward Dimers-2.37 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.688 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTGG
GCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCTT
CCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTC
CTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGAC
TATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTAT
GAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3571035 - 1391
Exon 7 To Exon 10 (Pair 10)
Forward (1012,22)CAGAACTTCCCAACCGTATTGAAmplicon SizecDNA: 380 bpgenomic: 4,774
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.713 kcal/mol in 3' area
Forward Dimers-0.646 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-0.997 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCA
TCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCA
AAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACT
TTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATA
CTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTG
GTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCA
TACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3801012 - 1391
Exon 7 To Exon 10 (Pair 11)
Forward (1015,22)AACTTCCCAACCGTATTGATGCAmplicon SizecDNA: 377 bpgenomic: 4,771
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.713 kcal/mol in 3' area
Forward Dimers-0.237 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-0.834 kcal/mol in 3' area
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCT
TCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAA
AAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTG
AGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTA
ACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTG
ATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATAC
AGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3771015 - 1391
Exon 7 To Exon 10 (Pair 12)
Forward (1016,22)ACTTCCCAACCGTATTGATGCTAmplicon SizecDNA: 376 bpgenomic: 4,770
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.713 kcal/mol
Forward Dimers-0.237 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-0.834 kcal/mol
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTT
CAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAA
AATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGA
GGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAA
CCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGA
TAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACA
GTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3761016 - 1391
Exon 7 To Exon 10 (Pair 13)
Forward (1014,22)GAACTTCCCAACCGTATTGATGAmplicon SizecDNA: 378 bpgenomic: 4,772
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.713 kcal/mol in 3' area
Forward Dimers-0.237 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-0.834 kcal/mol in 3' area
Amplicon Folding-2.555 kcal/mol outside primersite
Amplicon SequenceGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATC
TTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAA
AAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTT
GAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACT
AACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGT
GATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATA
CAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3781014 - 1391
Exon 8 To Exon 10 (Pair 1)
Forward (1204,21)GCAAGACTCTCCTGTTCTCAGAmplicon SizecDNA: 188 bpgenomic: 3,608
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.397 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.064 kcal/mol
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTA
TGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAG
ATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAAT
ACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1881204 - 1391
Exon 8 To Exon 10 (Pair 2)
Forward (1207,22)AGACTCTCCTGTTCTCAGGAAAAmplicon SizecDNA: 185 bpgenomic: 3,605
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops-0.848 kcal/mol in 3' area
Forward Dimers-1.877 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-0.816 kcal/mol
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGG
ATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATG
CTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACA
GCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1851207 - 1391
Exon 8 To Exon 10 (Pair 3)
Forward (1170,23)AAGATAAGTGCAGCTGTTCACTTAmplicon SizecDNA: 321 bpgenomic: 3,741
Reverse (1490,23)CCCAAATGCTCTTCAGGATTTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.438 kcal/mol in 3' area
Forward Dimers-3.624 kcal/mol
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.911 kcal/mol
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAAC
CAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATA
GAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTAT
ATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAACCGTATTGTT
CGCGTCATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTT
AAATCCTGAAGAGCATTTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3211170 - 1490
Exon 8 To Exon 10 (Pair 4)
Forward (1173,23)ATAAGTGCAGCTGTTCACTTTGAAmplicon SizecDNA: 317 bpgenomic: 3,737
Reverse (1489,24)CCAAATGCTCTTCAGGATTTAAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.304 kcal/mol in 3' area
Forward Dimers-3.624 kcal/mol
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.911 kcal/mol
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAG
GTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAA
GAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATC
TATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGC
GTCATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTTAAA
TCCTGAAGAGCATTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3171173 - 1489
Exon 8 To Exon 10 (Pair 5)
Forward (1159,24)AAGAAGTTAAGAAGATAAGTGCAGAmplicon SizecDNA: 331 bpgenomic: 3,751
Reverse (1489,24)CCAAATGCTCTTCAGGATTTAAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.131 kcal/mol
Forward Dimers-1.072 kcal/mol in 3' area
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.911 kcal/mol in 3' area
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGT
TCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATC
CGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGA
AAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTA
ACCGTATTGTTCGCGTCATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAA
AATTGTTATTTAAATCCTGAAGAGCATTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3311159 - 1489
Exon 8 To Exon 10 (Pair 6)
Forward (1210,21)CTCTCCTGTTCTCAGGAAACCAmplicon SizecDNA: 182 bpgenomic: 3,602
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops-0.848 kcal/mol
Forward Dimers-1.877 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-0.816 kcal/mol
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceCTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATA
AAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTG
TCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCA
TC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1821210 - 1391
Exon 8 To Exon 10 (Pair 7)
Forward (1173,23)ATAAGTGCAGCTGTTCACTTTGAAmplicon SizecDNA: 219 bpgenomic: 3,639
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.304 kcal/mol in 3' area
Forward Dimers-3.624 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAG
GTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAA
GAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATC
TATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)2191173 - 1391
Exon 8 To Exon 10 (Pair 8)
Forward (1175,22)AAGTGCAGCTGTTCACTTTGAGAmplicon SizecDNA: 315 bpgenomic: 3,735
Reverse (1489,24)CCAAATGCTCTTCAGGATTTAAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.438 kcal/mol
Forward Dimers-3.624 kcal/mol
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGT
CTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGA
AGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTA
TTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGCGT
CATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTTAAATC
CTGAAGAGCATTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3151175 - 1489
Exon 8 To Exon 10 (Pair 9)
Forward (1205,21)CAAGACTCTCCTGTTCTCAGGAmplicon SizecDNA: 187 bpgenomic: 3,607
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops-0.037 kcal/mol in 3' area
Forward Dimers-1.066 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.064 kcal/mol
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTAT
GGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGA
TGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATA
CAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1871205 - 1391
Exon 8 To Exon 10 (Pair 10)
Forward (1161,23)GAAGTTAAGAAGATAAGTGCAGCAmplicon SizecDNA: 231 bpgenomic: 3,651
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.585 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.128 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTC
TCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCG
AGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAA
AATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)2311161 - 1391
Exon 8 To Exon 10 (Pair 11)
Forward (1171,23)AGATAAGTGCAGCTGTTCACTTTAmplicon SizecDNA: 221 bpgenomic: 3,641
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.304 kcal/mol in 3' area
Forward Dimers-3.624 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACC
AGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAG
AAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATA
TCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)2211171 - 1391
Exon 8 To Exon 10 (Pair 12)
Forward (1212,21)CTCCTGTTCTCAGGAAACCAGAmplicon SizecDNA: 180 bpgenomic: 3,600
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops-0.848 kcal/mol
Forward Dimers-1.877 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.086 kcal/mol in 3' area
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAA
GACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTC
TATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1801212 - 1391
Exon 8 To Exon 10 (Pair 13)
Forward (1159,24)AAGAAGTTAAGAAGATAAGTGCAGAmplicon SizecDNA: 332 bpgenomic: 3,752
Reverse (1490,23)CCCAAATGCTCTTCAGGATTTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.131 kcal/mol
Forward Dimers-1.072 kcal/mol in 3' area
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.911 kcal/mol in 3' area
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGT
TCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATC
CGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGA
AAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTA
ACCGTATTGTTCGCGTCATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAA
AATTGTTATTTAAATCCTGAAGAGCATTTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3321159 - 1490
Exon 8 To Exon 10 (Pair 14)
Forward (1213,21)TCCTGTTCTCAGGAAACCAGGAmplicon SizecDNA: 179 bpgenomic: 3,599
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops-0.848 kcal/mol
Forward Dimers-1.877 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.086 kcal/mol in 3' area
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAG
ACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCT
ATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1791213 - 1391
Exon 8 To Exon 10 (Pair 15)
Forward (1161,23)GAAGTTAAGAAGATAAGTGCAGCAmplicon SizecDNA: 329 bpgenomic: 3,749
Reverse (1489,24)CCAAATGCTCTTCAGGATTTAAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.585 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol in 3' area
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.911 kcal/mol in 3' area
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTC
TCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCG
AGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAA
AATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAAC
CGTATTGTTCGCGTCATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAAAA
TTGTTATTTAAATCCTGAAGAGCATTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3291161 - 1489
Exon 8 To Exon 10 (Pair 16)
Forward (1159,24)AAGAAGTTAAGAAGATAAGTGCAGAmplicon SizecDNA: 233 bpgenomic: 3,653
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.131 kcal/mol
Forward Dimers-1.072 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.128 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGT
TCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATC
CGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGA
AAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)2331159 - 1391
Exon 8 To Exon 10 (Pair 17)
Forward (1175,22)AAGTGCAGCTGTTCACTTTGAGAmplicon SizecDNA: 316 bpgenomic: 3,736
Reverse (1490,23)CCCAAATGCTCTTCAGGATTTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.438 kcal/mol
Forward Dimers-3.624 kcal/mol
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGT
CTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGA
AGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTA
TTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGCGT
CATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTTAAATC
CTGAAGAGCATTTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3161175 - 1490
Exon 8 To Exon 10 (Pair 18)
Forward (1161,23)GAAGTTAAGAAGATAAGTGCAGCAmplicon SizecDNA: 330 bpgenomic: 3,750
Reverse (1490,23)CCCAAATGCTCTTCAGGATTTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.585 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol in 3' area
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.911 kcal/mol in 3' area
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTC
TCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCG
AGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAA
AATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAAC
CGTATTGTTCGCGTCATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAAAA
TTGTTATTTAAATCCTGAAGAGCATTTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3301161 - 1490
Exon 8 To Exon 10 (Pair 19)
Forward (1177,21)GTGCAGCTGTTCACTTTGAGGAmplicon SizecDNA: 215 bpgenomic: 3,635
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.651 kcal/mol in 3' area
Forward Dimers-3.624 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCT
GGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAG
ACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATT
TTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)2151177 - 1391
Exon 8 To Exon 10 (Pair 20)
Forward (1203,21)GGCAAGACTCTCCTGTTCTCAAmplicon SizecDNA: 189 bpgenomic: 3,609
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.351 kcal/mol
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATT
ATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTA
GATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAA
TACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1891203 - 1391
Exon 8 To Exon 10 (Pair 21)
Forward (1177,21)GTGCAGCTGTTCACTTTGAGGAmplicon SizecDNA: 313 bpgenomic: 3,733
Reverse (1489,24)CCAAATGCTCTTCAGGATTTAAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.651 kcal/mol in 3' area
Forward Dimers-3.624 kcal/mol
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCT
GGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAG
ACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATT
TTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGCGTCA
TGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTTAAATCCT
GAAGAGCATTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3131177 - 1489
Exon 8 To Exon 10 (Pair 22)
Forward (1170,23)AAGATAAGTGCAGCTGTTCACTTAmplicon SizecDNA: 222 bpgenomic: 3,642
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.438 kcal/mol in 3' area
Forward Dimers-3.624 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAAC
CAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATA
GAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTAT
ATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)2221170 - 1391
Exon 8 To Exon 10 (Pair 23)
Forward (1171,23)AGATAAGTGCAGCTGTTCACTTTAmplicon SizecDNA: 319 bpgenomic: 3,739
Reverse (1489,24)CCAAATGCTCTTCAGGATTTAAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.304 kcal/mol in 3' area
Forward Dimers-3.624 kcal/mol
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.911 kcal/mol
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACC
AGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAG
AAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATA
TCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAACCGTATTGTTC
GCGTCATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTTA
AATCCTGAAGAGCATTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3191171 - 1489
Exon 8 To Exon 10 (Pair 24)
Forward (1170,23)AAGATAAGTGCAGCTGTTCACTTAmplicon SizecDNA: 320 bpgenomic: 3,740
Reverse (1489,24)CCAAATGCTCTTCAGGATTTAAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.438 kcal/mol in 3' area
Forward Dimers-3.624 kcal/mol
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.911 kcal/mol
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAAC
CAGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATA
GAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTAT
ATCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAACCGTATTGTT
CGCGTCATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTT
AAATCCTGAAGAGCATTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3201170 - 1489
Exon 8 To Exon 10 (Pair 25)
Forward (1177,21)GTGCAGCTGTTCACTTTGAGGAmplicon SizecDNA: 314 bpgenomic: 3,734
Reverse (1490,23)CCCAAATGCTCTTCAGGATTTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.651 kcal/mol in 3' area
Forward Dimers-3.624 kcal/mol
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCT
GGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAG
ACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATT
TTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGCGTCA
TGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTTAAATCCT
GAAGAGCATTTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3141177 - 1490
Exon 8 To Exon 10 (Pair 26)
Forward (1171,23)AGATAAGTGCAGCTGTTCACTTTAmplicon SizecDNA: 320 bpgenomic: 3,740
Reverse (1490,23)CCCAAATGCTCTTCAGGATTTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.304 kcal/mol in 3' area
Forward Dimers-3.624 kcal/mol
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.911 kcal/mol
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACC
AGGTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAG
AAGAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATA
TCTATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAACCGTATTGTTC
GCGTCATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTTA
AATCCTGAAGAGCATTTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3201171 - 1490
Exon 8 To Exon 10 (Pair 27)
Forward (1175,22)AAGTGCAGCTGTTCACTTTGAGAmplicon SizecDNA: 217 bpgenomic: 3,637
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.438 kcal/mol
Forward Dimers-3.624 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGT
CTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAAGA
AGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTA
TTTTTTCAACGGACCCATACAGTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)2171175 - 1391
Exon 8 To Exon 10 (Pair 28)
Forward (1206,22)AAGACTCTCCTGTTCTCAGGAAAmplicon SizecDNA: 186 bpgenomic: 3,606
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops-0.848 kcal/mol in 3' area
Forward Dimers-1.877 kcal/mol in 3' area
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.064 kcal/mol
Amplicon Folding-1.795 kcal/mol inside primersite
Amplicon SequenceAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAGATATGATGATACTAACCATATTATG
GATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGATAAAGTAGAT
GCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACAGTTTGAATAC
AGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1861206 - 1391
Exon 8 To Exon 10 (Pair 29)
Forward (1173,23)ATAAGTGCAGCTGTTCACTTTGAAmplicon SizecDNA: 318 bpgenomic: 3,738
Reverse (1490,23)CCCAAATGCTCTTCAGGATTTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.304 kcal/mol in 3' area
Forward Dimers-3.624 kcal/mol
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.911 kcal/mol
Amplicon Folding-2.454 kcal/mol outside primersite
Amplicon SequenceATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAG
GTCTGGAGATATGATGATACTAACCATATTATGGATAAAGACTATCCGAGACTAATAGAA
GAAGACTTCCCAGGAATTGGTGATAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATC
TATTTTTTCAACGGACCCATACAGTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGC
GTCATGCCAGCAAATTCCATTTTGTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTTAAA
TCCTGAAGAGCATTTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3181173 - 1490
Exon 9 To Exon 10 (Pair 1)
Forward (1256,24)CCATATTATGGATAAAGACTATCCAmplicon SizecDNA: 140 bpgenomic: 1,419
Reverse (1395,23)TCCAGATGCTGTATTCAAACTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.043 kcal/mol
Forward Dimers-2.387 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.681 kcal/mol in 3' area
Forward-Reverse Dimers-1.659 kcal/mol
Amplicon Folding-0.659 kcal/mol inside primersite
Amplicon SequenceCCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGA
TAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACA
GTTTGAATACAGCATCTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1401256 - 1395
Exon 9 To Exon 10 (Pair 2)
Forward (1256,24)CCATATTATGGATAAAGACTATCCAmplicon SizecDNA: 282 bpgenomic: 1,561
Reverse (1537,21)CTCCTGATAGCTCTTCTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.043 kcal/mol
Forward Dimers-2.387 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol in 3' area
Amplicon Folding-0.885 kcal/mol inside primersite
Amplicon SequenceCCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGA
TAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACA
GTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGCGTCATGCCAGCAAATTCCATTTT
GTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTTAAATCCTGAAGAGCATTTGGGGTAAT
ACTTCCAGAAGTGCGGGGTAGGGGAAGAAGAGCTATCAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)2821256 - 1537
Exon 9 To Exon 10 (Pair 3)
Forward (1256,24)CCATATTATGGATAAAGACTATCCAmplicon SizecDNA: 143 bpgenomic: 1,422
Reverse (1398,23)TACTCCAGATGCTGTATTCAAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.043 kcal/mol
Forward Dimers-2.387 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.65 kcal/mol
Forward-Reverse Dimers-1.659 kcal/mol
Amplicon Folding-0.659 kcal/mol inside primersite
Amplicon SequenceCCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGA
TAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACA
GTTTGAATACAGCATCTGGAGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1431256 - 1398
Exon 9 To Exon 10 (Pair 4)
Forward (1256,24)CCATATTATGGATAAAGACTATCCAmplicon SizecDNA: 139 bpgenomic: 1,418
Reverse (1394,23)CCAGATGCTGTATTCAAACTGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.043 kcal/mol
Forward Dimers-2.387 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.354 kcal/mol
Amplicon Folding-0.659 kcal/mol inside primersite
Amplicon SequenceCCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGA
TAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACA
GTTTGAATACAGCATCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1391256 - 1394
Exon 9 To Exon 10 (Pair 5)
Forward (1256,24)CCATATTATGGATAAAGACTATCCAmplicon SizecDNA: 234 bpgenomic: 1,513
Reverse (1489,24)CCAAATGCTCTTCAGGATTTAAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.043 kcal/mol
Forward Dimers-2.387 kcal/mol
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.533 kcal/mol in 3' area
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceCCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGA
TAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACA
GTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGCGTCATGCCAGCAAATTCCATTTT
GTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTTAAATCCTGAAGAGCATTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)2341256 - 1489
Exon 9 To Exon 10 (Pair 6)
Forward (1256,24)CCATATTATGGATAAAGACTATCCAmplicon SizecDNA: 136 bpgenomic: 1,415
Reverse (1391,23)GATGCTGTATTCAAACTGTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.043 kcal/mol
Forward Dimers-2.387 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.826 kcal/mol in 3' area
Forward-Reverse Dimers-1.282 kcal/mol in 3' area
Amplicon Folding0.043 kcal/mol inside primersite
Amplicon SequenceCCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGA
TAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACA
GTTTGAATACAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1361256 - 1391
Exon 9 To Exon 10 (Pair 7)
Forward (1256,24)CCATATTATGGATAAAGACTATCCAmplicon SizecDNA: 142 bpgenomic: 1,421
Reverse (1397,23)ACTCCAGATGCTGTATTCAAACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.043 kcal/mol
Forward Dimers-2.387 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-0.65 kcal/mol
Forward-Reverse Dimers-1.659 kcal/mol
Amplicon Folding-0.659 kcal/mol inside primersite
Amplicon SequenceCCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGA
TAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACA
GTTTGAATACAGCATCTGGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1421256 - 1397
Exon 9 To Exon 10 (Pair 8)
Forward (1256,24)CCATATTATGGATAAAGACTATCCAmplicon SizecDNA: 400 bpgenomic: 1,679
Reverse (1655,23)AGAGATCCTCCATTTCATTACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.043 kcal/mol
Forward Dimers-2.387 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-0.739 kcal/mol in 3' area
Forward-Reverse Dimers-2.461 kcal/mol
Amplicon Folding-3.574 kcal/mol outside primersite
Amplicon SequenceCCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGA
TAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACA
GTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGCGTCATGCCAGCAAATTCCATTTT
GTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTTAAATCCTGAAGAGCATTTGGGGTAAT
ACTTCCAGAAGTGCGGGGTAGGGGAAGAAGAGCTATCAGGAGAAAGCTTGGTTCTGTGAA
CAAGCTTCAGTAAGTTATCTTTGAATATGTAGTATCTATATGACTATGCGTGGCTGGAAC
CACATTGAAGAATGTTAGAGTAATGAAATGGAGGATCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)4001256 - 1655
Exon 9 To Exon 10 (Pair 9)
Forward (1256,24)CCATATTATGGATAAAGACTATCCAmplicon SizecDNA: 287 bpgenomic: 1,566
Reverse (1542,22)GCTTTCTCCTGATAGCTCTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.043 kcal/mol
Forward Dimers-2.387 kcal/mol
Reverse Loops1.643 kcal/mol
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.585 kcal/mol
Amplicon Folding-0.885 kcal/mol inside primersite
Amplicon SequenceCCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGA
TAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACA
GTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGCGTCATGCCAGCAAATTCCATTTT
GTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTTAAATCCTGAAGAGCATTTGGGGTAAT
ACTTCCAGAAGTGCGGGGTAGGGGAAGAAGAGCTATCAGGAGAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)2871256 - 1542
Exon 9 To Exon 10 (Pair 10)
Forward (1256,24)CCATATTATGGATAAAGACTATCCAmplicon SizecDNA: 284 bpgenomic: 1,563
Reverse (1539,22)TTCTCCTGATAGCTCTTCTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.043 kcal/mol
Forward Dimers-2.387 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol in 3' area
Amplicon Folding-0.885 kcal/mol inside primersite
Amplicon SequenceCCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGA
TAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACA
GTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGCGTCATGCCAGCAAATTCCATTTT
GTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTTAAATCCTGAAGAGCATTTGGGGTAAT
ACTTCCAGAAGTGCGGGGTAGGGGAAGAAGAGCTATCAGGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)2841256 - 1539
Exon 9 To Exon 10 (Pair 11)
Forward (1256,24)CCATATTATGGATAAAGACTATCCAmplicon SizecDNA: 399 bpgenomic: 1,678
Reverse (1654,23)GAGATCCTCCATTTCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.043 kcal/mol
Forward Dimers-2.387 kcal/mol
Reverse Loops1.735 kcal/mol
Reverse Dimers-0.739 kcal/mol in 3' area
Forward-Reverse Dimers-2.461 kcal/mol
Amplicon Folding-3.574 kcal/mol outside primersite
Amplicon SequenceCCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGA
TAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACA
GTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGCGTCATGCCAGCAAATTCCATTTT
GTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTTAAATCCTGAAGAGCATTTGGGGTAAT
ACTTCCAGAAGTGCGGGGTAGGGGAAGAAGAGCTATCAGGAGAAAGCTTGGTTCTGTGAA
CAAGCTTCAGTAAGTTATCTTTGAATATGTAGTATCTATATGACTATGCGTGGCTGGAAC
CACATTGAAGAATGTTAGAGTAATGAAATGGAGGATCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)3991256 - 1654
Exon 9 To Exon 10 (Pair 12)
Forward (1256,24)CCATATTATGGATAAAGACTATCCAmplicon SizecDNA: 235 bpgenomic: 1,514
Reverse (1490,23)CCCAAATGCTCTTCAGGATTTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.043 kcal/mol
Forward Dimers-2.387 kcal/mol
Reverse Loops0.275 kcal/mol in 3' area
Reverse Dimers-1.849 kcal/mol in 3' area
Forward-Reverse Dimers-1.635 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceCCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGA
TAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACA
GTTTGAATACAGCATCTGGAGTAACCGTATTGTTCGCGTCATGCCAGCAAATTCCATTTT
GTGGTGTTAAGTGTCTTTTTAAAAATTGTTATTTAAATCCTGAAGAGCATTTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)2351256 - 1490
Exon 9 To Exon 10 (Pair 13)
Forward (1256,24)CCATATTATGGATAAAGACTATCCAmplicon SizecDNA: 145 bpgenomic: 1,424
Reverse (1400,23)GTTACTCCAGATGCTGTATTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.043 kcal/mol
Forward Dimers-2.387 kcal/mol
Reverse Loops1.633 kcal/mol in 3' area
Reverse Dimers-0.65 kcal/mol
Forward-Reverse Dimers-1.659 kcal/mol
Amplicon Folding-0.659 kcal/mol inside primersite
Amplicon SequenceCCATATTATGGATAAAGACTATCCGAGACTAATAGAAGAAGACTTCCCAGGAATTGGTGA
TAAAGTAGATGCTGTCTATGAGAAAAATGGTTATATCTATTTTTTCAACGGACCCATACA
GTTTGAATACAGCATCTGGAGTAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002427 (MMP13)1451256 - 1400
 

See below for some more details.

Program Output:

Loading ...