Design Results for nell1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-1.1 Minimal dG for amplicon folding-1.0
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 4 (Pair 1)
Forward (366,21)TTGGAGTTGCTCAGGTGTCTGAmplicon SizecDNA: 80 bpgenomic: 105,699
Reverse (445,23)TGCATGGATCTCTCTTTCTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops2.336 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACA
TAGAAAGAGAGATCCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)80281 - 360
NM_006157 (NELL1)80281 - 360
Exon 3 To Exon 4 (Pair 2)
Forward (368,20)GGAGTTGCTCAGGTGTCTGGAmplicon SizecDNA: 78 bpgenomic: 105,697
Reverse (445,23)TGCATGGATCTCTCTTTCTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.07 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops2.336 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATA
GAAAGAGAGATCCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)78283 - 360
NM_006157 (NELL1)78283 - 360
Exon 3 To Exon 4 (Pair 3)
Forward (365,21)CTTGGAGTTGCTCAGGTGTCTAmplicon SizecDNA: 81 bpgenomic: 105,700
Reverse (445,23)TGCATGGATCTCTCTTTCTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.458 kcal/mol
Forward Dimers-0.293 kcal/mol
Reverse Loops2.336 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceCTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGAC
ATAGAAAGAGAGATCCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)81280 - 360
NM_006157 (NELL1)81280 - 360
Exon 3 To Exon 4 (Pair 4)
Forward (365,21)CTTGGAGTTGCTCAGGTGTCTAmplicon SizecDNA: 83 bpgenomic: 105,702
Reverse (447,22)GCTGCATGGATCTCTCTTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.458 kcal/mol
Forward Dimers-0.293 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceCTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGAC
ATAGAAAGAGAGATCCATGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)83280 - 362
NM_006157 (NELL1)83280 - 362
Exon 3 To Exon 4 (Pair 5)
Forward (368,20)GGAGTTGCTCAGGTGTCTGGAmplicon SizecDNA: 80 bpgenomic: 105,699
Reverse (447,22)GCTGCATGGATCTCTCTTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.07 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATA
GAAAGAGAGATCCATGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)80283 - 362
NM_006157 (NELL1)80283 - 362
Exon 3 To Exon 4 (Pair 6)
Forward (366,21)TTGGAGTTGCTCAGGTGTCTGAmplicon SizecDNA: 82 bpgenomic: 105,701
Reverse (447,22)GCTGCATGGATCTCTCTTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACA
TAGAAAGAGAGATCCATGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)82281 - 362
NM_006157 (NELL1)82281 - 362
Exon 4 To Exon 5 (Pair 1)
Forward (534,22)CTTCAGGAGTGATACTGTCCATAmplicon SizecDNA: 108 bpgenomic: 63,860
Reverse (641,22)GCTTCCCATTGTGTATGTAGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops1.902 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceCTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCA
GTGGCCTGAGGGATGAGATTCGGTATCACTACATACACAATGGGAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)108449 - 556
NM_006157 (NELL1)108449 - 556
Exon 4 To Exon 5 (Pair 2)
Forward (534,22)CTTCAGGAGTGATACTGTCCATAmplicon SizecDNA: 109 bpgenomic: 63,861
Reverse (642,22)GGCTTCCCATTGTGTATGTAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops1.539 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceCTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCA
GTGGCCTGAGGGATGAGATTCGGTATCACTACATACACAATGGGAAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)109449 - 557
NM_006157 (NELL1)109449 - 557
Exon 4 To Exon 5 (Pair 3)
Forward (534,22)CTTCAGGAGTGATACTGTCCATAmplicon SizecDNA: 112 bpgenomic: 63,864
Reverse (645,22)CTTGGCTTCCCATTGTGTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.897 kcal/mol
Reverse Dimers-0.276 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceCTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCA
GTGGCCTGAGGGATGAGATTCGGTATCACTACATACACAATGGGAAGCCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)112449 - 560
NM_006157 (NELL1)112449 - 560
Exon 4 To Exon 5 (Pair 4)
Forward (536,22)TCAGGAGTGATACTGTCCATTCAmplicon SizecDNA: 92 bpgenomic: 63,844
Reverse (627,23)ATGTAGTGATACCGAATCTCATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.9 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCAGT
GGCCTGAGGGATGAGATTCGGTATCACTACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)92451 - 542
NM_006157 (NELL1)92451 - 542
Exon 4 To Exon 5 (Pair 5)
Forward (536,22)TCAGGAGTGATACTGTCCATTCAmplicon SizecDNA: 110 bpgenomic: 63,862
Reverse (645,22)CTTGGCTTCCCATTGTGTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.897 kcal/mol
Reverse Dimers-0.276 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCAGT
GGCCTGAGGGATGAGATTCGGTATCACTACATACACAATGGGAAGCCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)110451 - 560
NM_006157 (NELL1)110451 - 560
Exon 4 To Exon 5 (Pair 6)
Forward (533,22)ACTTCAGGAGTGATACTGTCCAAmplicon SizecDNA: 99 bpgenomic: 63,851
Reverse (631,23)GTGTATGTAGTGATACCGAATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.9 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceACTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGC
AGTGGCCTGAGGGATGAGATTCGGTATCACTACATACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)99448 - 546
NM_006157 (NELL1)99448 - 546
Exon 4 To Exon 5 (Pair 7)
Forward (534,22)CTTCAGGAGTGATACTGTCCATAmplicon SizecDNA: 92 bpgenomic: 63,844
Reverse (625,22)GTAGTGATACCGAATCTCATCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops1.17 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceCTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCA
GTGGCCTGAGGGATGAGATTCGGTATCACTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)92449 - 540
NM_006157 (NELL1)92449 - 540
Exon 4 To Exon 5 (Pair 8)
Forward (534,22)CTTCAGGAGTGATACTGTCCATAmplicon SizecDNA: 96 bpgenomic: 63,848
Reverse (629,23)GTATGTAGTGATACCGAATCTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.9 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceCTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCA
GTGGCCTGAGGGATGAGATTCGGTATCACTACATAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)96449 - 544
NM_006157 (NELL1)96449 - 544
Exon 4 To Exon 5 (Pair 9)
Forward (533,22)ACTTCAGGAGTGATACTGTCCAAmplicon SizecDNA: 93 bpgenomic: 63,845
Reverse (625,22)GTAGTGATACCGAATCTCATCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops1.17 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceACTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGC
AGTGGCCTGAGGGATGAGATTCGGTATCACTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)93448 - 540
NM_006157 (NELL1)93448 - 540
Exon 4 To Exon 5 (Pair 10)
Forward (533,22)ACTTCAGGAGTGATACTGTCCAAmplicon SizecDNA: 110 bpgenomic: 63,862
Reverse (642,22)GGCTTCCCATTGTGTATGTAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops1.539 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceACTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGC
AGTGGCCTGAGGGATGAGATTCGGTATCACTACATACACAATGGGAAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)110448 - 557
NM_006157 (NELL1)110448 - 557
Exon 4 To Exon 5 (Pair 11)
Forward (533,22)ACTTCAGGAGTGATACTGTCCAAmplicon SizecDNA: 109 bpgenomic: 63,861
Reverse (641,22)GCTTCCCATTGTGTATGTAGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops1.902 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceACTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGC
AGTGGCCTGAGGGATGAGATTCGGTATCACTACATACACAATGGGAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)109448 - 556
NM_006157 (NELL1)109448 - 556
Exon 4 To Exon 5 (Pair 12)
Forward (533,22)ACTTCAGGAGTGATACTGTCCAAmplicon SizecDNA: 108 bpgenomic: 63,860
Reverse (640,23)CTTCCCATTGTGTATGTAGTGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops1.902 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceACTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGC
AGTGGCCTGAGGGATGAGATTCGGTATCACTACATACACAATGGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)108448 - 555
NM_006157 (NELL1)108448 - 555
Exon 4 To Exon 5 (Pair 13)
Forward (536,22)TCAGGAGTGATACTGTCCATTCAmplicon SizecDNA: 90 bpgenomic: 63,842
Reverse (625,22)GTAGTGATACCGAATCTCATCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops1.17 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCAGT
GGCCTGAGGGATGAGATTCGGTATCACTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)90451 - 540
NM_006157 (NELL1)90451 - 540
Exon 4 To Exon 5 (Pair 14)
Forward (534,22)CTTCAGGAGTGATACTGTCCATAmplicon SizecDNA: 107 bpgenomic: 63,859
Reverse (640,23)CTTCCCATTGTGTATGTAGTGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops1.902 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceCTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCA
GTGGCCTGAGGGATGAGATTCGGTATCACTACATACACAATGGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)107449 - 555
NM_006157 (NELL1)107449 - 555
Exon 4 To Exon 5 (Pair 15)
Forward (536,22)TCAGGAGTGATACTGTCCATTCAmplicon SizecDNA: 89 bpgenomic: 63,841
Reverse (624,22)TAGTGATACCGAATCTCATCCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops1.435 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCAGT
GGCCTGAGGGATGAGATTCGGTATCACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)89451 - 539
NM_006157 (NELL1)89451 - 539
Exon 4 To Exon 5 (Pair 16)
Forward (534,22)CTTCAGGAGTGATACTGTCCATAmplicon SizecDNA: 91 bpgenomic: 63,843
Reverse (624,22)TAGTGATACCGAATCTCATCCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops1.435 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceCTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCA
GTGGCCTGAGGGATGAGATTCGGTATCACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)91449 - 539
NM_006157 (NELL1)91449 - 539
Exon 4 To Exon 5 (Pair 17)
Forward (536,22)TCAGGAGTGATACTGTCCATTCAmplicon SizecDNA: 108 bpgenomic: 63,860
Reverse (643,22)TGGCTTCCCATTGTGTATGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.968 kcal/mol
Reverse Dimers-0.205 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCAGT
GGCCTGAGGGATGAGATTCGGTATCACTACATACACAATGGGAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)108451 - 558
NM_006157 (NELL1)108451 - 558
Exon 4 To Exon 5 (Pair 18)
Forward (533,22)ACTTCAGGAGTGATACTGTCCAAmplicon SizecDNA: 97 bpgenomic: 63,849
Reverse (629,23)GTATGTAGTGATACCGAATCTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.9 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceACTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGC
AGTGGCCTGAGGGATGAGATTCGGTATCACTACATAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)97448 - 544
NM_006157 (NELL1)97448 - 544
Exon 4 To Exon 5 (Pair 19)
Forward (533,22)ACTTCAGGAGTGATACTGTCCAAmplicon SizecDNA: 95 bpgenomic: 63,847
Reverse (627,23)ATGTAGTGATACCGAATCTCATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.9 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceACTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGC
AGTGGCCTGAGGGATGAGATTCGGTATCACTACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)95448 - 542
NM_006157 (NELL1)95448 - 542
Exon 4 To Exon 5 (Pair 20)
Forward (536,22)TCAGGAGTGATACTGTCCATTCAmplicon SizecDNA: 105 bpgenomic: 63,857
Reverse (640,23)CTTCCCATTGTGTATGTAGTGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops1.902 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCAGT
GGCCTGAGGGATGAGATTCGGTATCACTACATACACAATGGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)105451 - 555
NM_006157 (NELL1)105451 - 555
Exon 4 To Exon 5 (Pair 21)
Forward (534,22)CTTCAGGAGTGATACTGTCCATAmplicon SizecDNA: 94 bpgenomic: 63,846
Reverse (627,23)ATGTAGTGATACCGAATCTCATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.9 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceCTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCA
GTGGCCTGAGGGATGAGATTCGGTATCACTACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)94449 - 542
NM_006157 (NELL1)94449 - 542
Exon 4 To Exon 5 (Pair 22)
Forward (534,22)CTTCAGGAGTGATACTGTCCATAmplicon SizecDNA: 110 bpgenomic: 63,862
Reverse (643,22)TGGCTTCCCATTGTGTATGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.968 kcal/mol
Reverse Dimers-0.205 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceCTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCA
GTGGCCTGAGGGATGAGATTCGGTATCACTACATACACAATGGGAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)110449 - 558
NM_006157 (NELL1)110449 - 558
Exon 4 To Exon 5 (Pair 23)
Forward (533,22)ACTTCAGGAGTGATACTGTCCAAmplicon SizecDNA: 98 bpgenomic: 63,850
Reverse (630,23)TGTATGTAGTGATACCGAATCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.9 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceACTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGC
AGTGGCCTGAGGGATGAGATTCGGTATCACTACATACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)98448 - 545
NM_006157 (NELL1)98448 - 545
Exon 4 To Exon 5 (Pair 24)
Forward (536,22)TCAGGAGTGATACTGTCCATTCAmplicon SizecDNA: 107 bpgenomic: 63,859
Reverse (642,22)GGCTTCCCATTGTGTATGTAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops1.539 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCAGT
GGCCTGAGGGATGAGATTCGGTATCACTACATACACAATGGGAAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)107451 - 557
NM_006157 (NELL1)107451 - 557
Exon 4 To Exon 5 (Pair 25)
Forward (533,22)ACTTCAGGAGTGATACTGTCCAAmplicon SizecDNA: 111 bpgenomic: 63,863
Reverse (643,22)TGGCTTCCCATTGTGTATGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.968 kcal/mol
Reverse Dimers-0.205 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceACTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGC
AGTGGCCTGAGGGATGAGATTCGGTATCACTACATACACAATGGGAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)111448 - 558
NM_006157 (NELL1)111448 - 558
Exon 4 To Exon 5 (Pair 26)
Forward (536,22)TCAGGAGTGATACTGTCCATTCAmplicon SizecDNA: 96 bpgenomic: 63,848
Reverse (631,23)GTGTATGTAGTGATACCGAATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.9 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCAGT
GGCCTGAGGGATGAGATTCGGTATCACTACATACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)96451 - 546
NM_006157 (NELL1)96451 - 546
Exon 4 To Exon 5 (Pair 27)
Forward (534,22)CTTCAGGAGTGATACTGTCCATAmplicon SizecDNA: 98 bpgenomic: 63,850
Reverse (631,23)GTGTATGTAGTGATACCGAATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.9 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceCTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCA
GTGGCCTGAGGGATGAGATTCGGTATCACTACATACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)98449 - 546
NM_006157 (NELL1)98449 - 546
Exon 4 To Exon 5 (Pair 28)
Forward (534,22)CTTCAGGAGTGATACTGTCCATAmplicon SizecDNA: 97 bpgenomic: 63,849
Reverse (630,23)TGTATGTAGTGATACCGAATCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.9 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceCTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCA
GTGGCCTGAGGGATGAGATTCGGTATCACTACATACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)97449 - 545
NM_006157 (NELL1)97449 - 545
Exon 4 To Exon 5 (Pair 29)
Forward (536,22)TCAGGAGTGATACTGTCCATTCAmplicon SizecDNA: 94 bpgenomic: 63,846
Reverse (629,23)GTATGTAGTGATACCGAATCTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.9 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCAGT
GGCCTGAGGGATGAGATTCGGTATCACTACATAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)94451 - 544
NM_006157 (NELL1)94451 - 544
Exon 4 To Exon 5 (Pair 30)
Forward (533,22)ACTTCAGGAGTGATACTGTCCAAmplicon SizecDNA: 113 bpgenomic: 63,865
Reverse (645,22)CTTGGCTTCCCATTGTGTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.897 kcal/mol
Reverse Dimers-0.276 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceACTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGC
AGTGGCCTGAGGGATGAGATTCGGTATCACTACATACACAATGGGAAGCCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)113448 - 560
NM_006157 (NELL1)113448 - 560
Exon 4 To Exon 5 (Pair 31)
Forward (536,22)TCAGGAGTGATACTGTCCATTCAmplicon SizecDNA: 95 bpgenomic: 63,847
Reverse (630,23)TGTATGTAGTGATACCGAATCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops0.9 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCAGT
GGCCTGAGGGATGAGATTCGGTATCACTACATACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)95451 - 545
NM_006157 (NELL1)95451 - 545
Exon 4 To Exon 5 (Pair 32)
Forward (536,22)TCAGGAGTGATACTGTCCATTCAmplicon SizecDNA: 106 bpgenomic: 63,858
Reverse (641,22)GCTTCCCATTGTGTATGTAGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops1.902 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGCAGT
GGCCTGAGGGATGAGATTCGGTATCACTACATACACAATGGGAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)106451 - 556
NM_006157 (NELL1)106451 - 556
Exon 4 To Exon 5 (Pair 33)
Forward (533,22)ACTTCAGGAGTGATACTGTCCAAmplicon SizecDNA: 92 bpgenomic: 63,844
Reverse (624,22)TAGTGATACCGAATCTCATCCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.947 kcal/mol
Forward Dimers-0.889 kcal/mol
Reverse Loops1.435 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.014 kcal/mol
Amplicon Folding-0.702 kcal/mol outside primersite
Amplicon SequenceACTTCAGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAACTGGAGAGC
AGTGGCCTGAGGGATGAGATTCGGTATCACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)92448 - 539
NM_006157 (NELL1)92448 - 539
 

See below for some more details.

Program Output:

Loading ...