Design Results for nell1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 4 (Pair 1)
Forward (372,21)TTGCTCAGGTGTCTGGAATGCAmplicon SizecDNA: 195 bpgenomic: 105,814
Reverse (566,22)CCAGTTCTCGAATGGACAGTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-0.052 kcal/mol
Reverse Loops0.494 kcal/mol
Reverse Dimers-1.308 kcal/mol
Forward-Reverse Dimers-2.031 kcal/mol
Amplicon Folding-2.374 kcal/mol outside primersite
Amplicon SequenceTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCCTCATGTGAGTGAGAAATTAATTCAGCTGTTCCGGAACAAGA
GTGAATTCACCATTTTGGCCACTGTACAGCAGAAGCCATCCACTTCAGGAGTGATACTGT
CCATTCGAGAACTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)195287 - 481
NM_006157 (NELL1)195287 - 481
Exon 3 To Exon 4 (Pair 2)
Forward (317,22)GACCTTCAGATGGATATCGTCAAmplicon SizecDNA: 140 bpgenomic: 105,759
Reverse (456,21)ACATGAGGAGCTGCATGGATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.172 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCT
CAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAG
ATCCATGCAGCTCCTCATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)140232 - 371
NM_006157 (NELL1)140232 - 371
Exon 3 To Exon 4 (Pair 3)
Forward (372,21)TTGCTCAGGTGTCTGGAATGCAmplicon SizecDNA: 84 bpgenomic: 105,703
Reverse (455,21)CATGAGGAGCTGCATGGATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-0.052 kcal/mol
Reverse Loops1.714 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.179 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCCTCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)84287 - 370
NM_006157 (NELL1)84287 - 370
Exon 3 To Exon 4 (Pair 4)
Forward (318,22)ACCTTCAGATGGATATCGTCACAmplicon SizecDNA: 134 bpgenomic: 105,753
Reverse (451,21)AGGAGCTGCATGGATCTCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.991 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTC
AGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGA
TCCATGCAGCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)134233 - 366
NM_006157 (NELL1)134233 - 366
Exon 3 To Exon 4 (Pair 5)
Forward (365,21)CTTGGAGTTGCTCAGGTGTCTAmplicon SizecDNA: 81 bpgenomic: 105,700
Reverse (445,23)TGCATGGATCTCTCTTTCTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.458 kcal/mol
Forward Dimers-0.293 kcal/mol
Reverse Loops2.336 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceCTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGAC
ATAGAAAGAGAGATCCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)81280 - 360
NM_006157 (NELL1)81280 - 360
Exon 3 To Exon 4 (Pair 6)
Forward (332,21)ATCGTCACCGAGCTTGACCTTAmplicon SizecDNA: 114 bpgenomic: 105,733
Reverse (445,23)TGCATGGATCTCTCTTTCTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops2.336 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.127 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTCAGGTGTCTGGAATG
CACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGATCCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)114247 - 360
NM_006157 (NELL1)114247 - 360
Exon 3 To Exon 4 (Pair 7)
Forward (316,22)TGACCTTCAGATGGATATCGTCAmplicon SizecDNA: 142 bpgenomic: 105,761
Reverse (457,21)CACATGAGGAGCTGCATGGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.172 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGC
TCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGA
GATCCATGCAGCTCCTCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)142231 - 372
NM_006157 (NELL1)142231 - 372
Exon 3 To Exon 4 (Pair 8)
Forward (360,20)CCACCCTTGGAGTTGCTCAGAmplicon SizecDNA: 86 bpgenomic: 105,705
Reverse (445,23)TGCATGGATCTCTCTTTCTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.492 kcal/mol
Forward Dimers-0.691 kcal/mol
Reverse Loops2.336 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.38 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceCCACCCTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTC
AAGACATAGAAAGAGAGATCCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)86275 - 360
NM_006157 (NELL1)86275 - 360
Exon 3 To Exon 4 (Pair 9)
Forward (311,21)GACCCTGACCTTCAGATGGATAmplicon SizecDNA: 147 bpgenomic: 105,766
Reverse (457,21)CACATGAGGAGCTGCATGGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.246 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.172 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGA
GTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAA
AGAGAGATCCATGCAGCTCCTCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)147226 - 372
NM_006157 (NELL1)147226 - 372
Exon 3 To Exon 4 (Pair 10)
Forward (331,21)TATCGTCACCGAGCTTGACCTAmplicon SizecDNA: 118 bpgenomic: 105,737
Reverse (448,22)AGCTGCATGGATCTCTCTTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.65 kcal/mol
Forward-Reverse Dimers-2.736 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceTATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTCAGGTGTCTGGAAT
GCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGATCCATGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)118246 - 363
NM_006157 (NELL1)118246 - 363
Exon 3 To Exon 4 (Pair 11)
Forward (311,21)GACCCTGACCTTCAGATGGATAmplicon SizecDNA: 144 bpgenomic: 105,763
Reverse (454,21)ATGAGGAGCTGCATGGATCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.246 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGA
GTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAA
AGAGAGATCCATGCAGCTCCTCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)144226 - 369
NM_006157 (NELL1)144226 - 369
Exon 3 To Exon 4 (Pair 12)
Forward (366,21)TTGGAGTTGCTCAGGTGTCTGAmplicon SizecDNA: 88 bpgenomic: 105,707
Reverse (453,21)TGAGGAGCTGCATGGATCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACA
TAGAAAGAGAGATCCATGCAGCTCCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)88281 - 368
NM_006157 (NELL1)88281 - 368
Exon 3 To Exon 4 (Pair 13)
Forward (315,22)CTGACCTTCAGATGGATATCGTAmplicon SizecDNA: 139 bpgenomic: 105,758
Reverse (453,21)TGAGGAGCTGCATGGATCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.457 kcal/mol
Forward Dimers-1.015 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTG
CTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAG
AGATCCATGCAGCTCCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)139230 - 368
NM_006157 (NELL1)139230 - 368
Exon 3 To Exon 4 (Pair 14)
Forward (312,22)ACCCTGACCTTCAGATGGATATAmplicon SizecDNA: 140 bpgenomic: 105,759
Reverse (451,21)AGGAGCTGCATGGATCTCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.246 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.991 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAG
TTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)140227 - 366
NM_006157 (NELL1)140227 - 366
Exon 3 To Exon 4 (Pair 15)
Forward (366,21)TTGGAGTTGCTCAGGTGTCTGAmplicon SizecDNA: 207 bpgenomic: 105,826
Reverse (572,21)TGTGCTCCAGTTCTCGAATGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops1 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.443 kcal/mol
Amplicon Folding-2.374 kcal/mol outside primersite
Amplicon SequenceTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACA
TAGAAAGAGAGATCCATGCAGCTCCTCATGTGAGTGAGAAATTAATTCAGCTGTTCCGGA
ACAAGAGTGAATTCACCATTTTGGCCACTGTACAGCAGAAGCCATCCACTTCAGGAGTGA
TACTGTCCATTCGAGAACTGGAGCACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)207281 - 487
NM_006157 (NELL1)207281 - 487
Exon 3 To Exon 4 (Pair 16)
Forward (336,21)TCACCGAGCTTGACCTTGTGAAmplicon SizecDNA: 110 bpgenomic: 105,729
Reverse (445,23)TGCATGGATCTCTCTTTCTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.486 kcal/mol in 3' area
Forward Dimers-2.948 kcal/mol
Reverse Loops2.336 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.127 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTCAGGTGTCTGGAATGCACA
ATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGATCCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)110251 - 360
NM_006157 (NELL1)110251 - 360
Exon 3 To Exon 4 (Pair 17)
Forward (318,22)ACCTTCAGATGGATATCGTCACAmplicon SizecDNA: 141 bpgenomic: 105,760
Reverse (458,21)TCACATGAGGAGCTGCATGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.172 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTC
AGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGA
TCCATGCAGCTCCTCATGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)141233 - 373
NM_006157 (NELL1)141233 - 373
Exon 3 To Exon 4 (Pair 18)
Forward (368,20)GGAGTTGCTCAGGTGTCTGGAmplicon SizecDNA: 78 bpgenomic: 105,697
Reverse (445,23)TGCATGGATCTCTCTTTCTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.07 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops2.336 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATA
GAAAGAGAGATCCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)78283 - 360
NM_006157 (NELL1)78283 - 360
Exon 3 To Exon 4 (Pair 19)
Forward (318,22)ACCTTCAGATGGATATCGTCACAmplicon SizecDNA: 130 bpgenomic: 105,749
Reverse (447,22)GCTGCATGGATCTCTCTTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTC
AGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGA
TCCATGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)130233 - 362
NM_006157 (NELL1)130233 - 362
Exon 3 To Exon 4 (Pair 20)
Forward (312,22)ACCCTGACCTTCAGATGGATATAmplicon SizecDNA: 136 bpgenomic: 105,755
Reverse (447,22)GCTGCATGGATCTCTCTTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.246 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAG
TTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)136227 - 362
NM_006157 (NELL1)136227 - 362
Exon 3 To Exon 4 (Pair 21)
Forward (330,21)ATATCGTCACCGAGCTTGACCAmplicon SizecDNA: 118 bpgenomic: 105,737
Reverse (447,22)GCTGCATGGATCTCTCTTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.519 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTCAGGTGTCTGGAA
TGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGATCCATGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)118245 - 362
NM_006157 (NELL1)118245 - 362
Exon 3 To Exon 4 (Pair 22)
Forward (365,21)CTTGGAGTTGCTCAGGTGTCTAmplicon SizecDNA: 84 bpgenomic: 105,703
Reverse (448,22)AGCTGCATGGATCTCTCTTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.458 kcal/mol
Forward Dimers-0.293 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.65 kcal/mol
Forward-Reverse Dimers-1.339 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceCTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGAC
ATAGAAAGAGAGATCCATGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)84280 - 363
NM_006157 (NELL1)84280 - 363
Exon 3 To Exon 4 (Pair 23)
Forward (372,21)TTGCTCAGGTGTCTGGAATGCAmplicon SizecDNA: 80 bpgenomic: 105,699
Reverse (451,21)AGGAGCTGCATGGATCTCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-0.052 kcal/mol
Reverse Loops1.991 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.179 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)80287 - 366
NM_006157 (NELL1)80287 - 366
Exon 3 To Exon 4 (Pair 24)
Forward (312,22)ACCCTGACCTTCAGATGGATATAmplicon SizecDNA: 147 bpgenomic: 105,766
Reverse (458,21)TCACATGAGGAGCTGCATGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.246 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.172 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAG
TTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCCTCATGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)147227 - 373
NM_006157 (NELL1)147227 - 373
Exon 3 To Exon 4 (Pair 25)
Forward (311,21)GACCCTGACCTTCAGATGGATAmplicon SizecDNA: 146 bpgenomic: 105,765
Reverse (456,21)ACATGAGGAGCTGCATGGATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.246 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.172 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGA
GTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAA
AGAGAGATCCATGCAGCTCCTCATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)146226 - 371
NM_006157 (NELL1)146226 - 371
Exon 3 To Exon 4 (Pair 26)
Forward (366,21)TTGGAGTTGCTCAGGTGTCTGAmplicon SizecDNA: 89 bpgenomic: 105,708
Reverse (454,21)ATGAGGAGCTGCATGGATCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.594 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACA
TAGAAAGAGAGATCCATGCAGCTCCTCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)89281 - 369
NM_006157 (NELL1)89281 - 369
Exon 3 To Exon 4 (Pair 27)
Forward (306,20)GGATGGACCCTGACCTTCAGAmplicon SizecDNA: 140 bpgenomic: 105,759
Reverse (445,23)TGCATGGATCTCTCTTTCTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.057 kcal/mol in 3' area
Forward Dimers-0.566 kcal/mol
Reverse Loops2.336 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.025 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGGATGGACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCC
TTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACA
TAGAAAGAGAGATCCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)140221 - 360
NM_006157 (NELL1)140221 - 360
Exon 3 To Exon 4 (Pair 28)
Forward (315,22)CTGACCTTCAGATGGATATCGTAmplicon SizecDNA: 136 bpgenomic: 105,755
Reverse (450,21)GGAGCTGCATGGATCTCTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.457 kcal/mol
Forward Dimers-1.015 kcal/mol
Reverse Loops2.008 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTG
CTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAG
AGATCCATGCAGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)136230 - 365
NM_006157 (NELL1)136230 - 365
Exon 3 To Exon 4 (Pair 29)
Forward (318,22)ACCTTCAGATGGATATCGTCACAmplicon SizecDNA: 138 bpgenomic: 105,757
Reverse (455,21)CATGAGGAGCTGCATGGATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.714 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTC
AGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGA
TCCATGCAGCTCCTCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)138233 - 370
NM_006157 (NELL1)138233 - 370
Exon 3 To Exon 4 (Pair 30)
Forward (316,22)TGACCTTCAGATGGATATCGTCAmplicon SizecDNA: 138 bpgenomic: 105,757
Reverse (453,21)TGAGGAGCTGCATGGATCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGC
TCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGA
GATCCATGCAGCTCCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)138231 - 368
NM_006157 (NELL1)138231 - 368
Exon 3 To Exon 4 (Pair 31)
Forward (316,22)TGACCTTCAGATGGATATCGTCAmplicon SizecDNA: 130 bpgenomic: 105,749
Reverse (445,23)TGCATGGATCTCTCTTTCTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops2.336 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGC
TCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGA
GATCCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)130231 - 360
NM_006157 (NELL1)130231 - 360
Exon 3 To Exon 4 (Pair 32)
Forward (317,22)GACCTTCAGATGGATATCGTCAAmplicon SizecDNA: 135 bpgenomic: 105,754
Reverse (451,21)AGGAGCTGCATGGATCTCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.991 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCT
CAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAG
ATCCATGCAGCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)135232 - 366
NM_006157 (NELL1)135232 - 366
Exon 3 To Exon 4 (Pair 33)
Forward (372,21)TTGCTCAGGTGTCTGGAATGCAmplicon SizecDNA: 201 bpgenomic: 105,820
Reverse (572,21)TGTGCTCCAGTTCTCGAATGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-0.052 kcal/mol
Reverse Loops1 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.336 kcal/mol
Amplicon Folding-2.374 kcal/mol outside primersite
Amplicon SequenceTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCCTCATGTGAGTGAGAAATTAATTCAGCTGTTCCGGAACAAGA
GTGAATTCACCATTTTGGCCACTGTACAGCAGAAGCCATCCACTTCAGGAGTGATACTGT
CCATTCGAGAACTGGAGCACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)201287 - 487
NM_006157 (NELL1)201287 - 487
Exon 3 To Exon 4 (Pair 34)
Forward (365,21)CTTGGAGTTGCTCAGGTGTCTAmplicon SizecDNA: 90 bpgenomic: 105,709
Reverse (454,21)ATGAGGAGCTGCATGGATCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.458 kcal/mol
Forward Dimers-0.293 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.594 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceCTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGAC
ATAGAAAGAGAGATCCATGCAGCTCCTCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)90280 - 369
NM_006157 (NELL1)90280 - 369
Exon 3 To Exon 4 (Pair 35)
Forward (315,22)CTGACCTTCAGATGGATATCGTAmplicon SizecDNA: 143 bpgenomic: 105,762
Reverse (457,21)CACATGAGGAGCTGCATGGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.457 kcal/mol
Forward Dimers-1.015 kcal/mol
Reverse Loops1.172 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTG
CTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAG
AGATCCATGCAGCTCCTCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)143230 - 372
NM_006157 (NELL1)143230 - 372
Exon 3 To Exon 4 (Pair 36)
Forward (360,20)CCACCCTTGGAGTTGCTCAGAmplicon SizecDNA: 89 bpgenomic: 105,708
Reverse (448,22)AGCTGCATGGATCTCTCTTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.492 kcal/mol
Forward Dimers-0.691 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.65 kcal/mol
Forward-Reverse Dimers-1.541 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceCCACCCTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTC
AAGACATAGAAAGAGAGATCCATGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)89275 - 363
NM_006157 (NELL1)89275 - 363
Exon 3 To Exon 4 (Pair 37)
Forward (366,21)TTGGAGTTGCTCAGGTGTCTGAmplicon SizecDNA: 202 bpgenomic: 105,821
Reverse (567,22)TCCAGTTCTCGAATGGACAGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops0.189 kcal/mol
Reverse Dimers-1.613 kcal/mol
Forward-Reverse Dimers-1.429 kcal/mol
Amplicon Folding-2.374 kcal/mol outside primersite
Amplicon SequenceTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACA
TAGAAAGAGAGATCCATGCAGCTCCTCATGTGAGTGAGAAATTAATTCAGCTGTTCCGGA
ACAAGAGTGAATTCACCATTTTGGCCACTGTACAGCAGAAGCCATCCACTTCAGGAGTGA
TACTGTCCATTCGAGAACTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)202281 - 482
NM_006157 (NELL1)202281 - 482
Exon 3 To Exon 4 (Pair 38)
Forward (311,21)GACCCTGACCTTCAGATGGATAmplicon SizecDNA: 141 bpgenomic: 105,760
Reverse (451,21)AGGAGCTGCATGGATCTCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.246 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.991 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGA
GTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAA
AGAGAGATCCATGCAGCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)141226 - 366
NM_006157 (NELL1)141226 - 366
Exon 3 To Exon 4 (Pair 39)
Forward (372,21)TTGCTCAGGTGTCTGGAATGCAmplicon SizecDNA: 83 bpgenomic: 105,702
Reverse (454,21)ATGAGGAGCTGCATGGATCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-0.052 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.179 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCCTCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)83287 - 369
NM_006157 (NELL1)83287 - 369
Exon 3 To Exon 4 (Pair 40)
Forward (318,22)ACCTTCAGATGGATATCGTCACAmplicon SizecDNA: 133 bpgenomic: 105,752
Reverse (450,21)GGAGCTGCATGGATCTCTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops2.008 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTC
AGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGA
TCCATGCAGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)133233 - 365
NM_006157 (NELL1)133233 - 365
Exon 3 To Exon 4 (Pair 41)
Forward (360,20)CCACCCTTGGAGTTGCTCAGAmplicon SizecDNA: 213 bpgenomic: 105,832
Reverse (572,21)TGTGCTCCAGTTCTCGAATGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.492 kcal/mol
Forward Dimers-0.691 kcal/mol
Reverse Loops1 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.443 kcal/mol
Amplicon Folding-2.374 kcal/mol outside primersite
Amplicon SequenceCCACCCTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTC
AAGACATAGAAAGAGAGATCCATGCAGCTCCTCATGTGAGTGAGAAATTAATTCAGCTGT
TCCGGAACAAGAGTGAATTCACCATTTTGGCCACTGTACAGCAGAAGCCATCCACTTCAG
GAGTGATACTGTCCATTCGAGAACTGGAGCACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)213275 - 487
NM_006157 (NELL1)213275 - 487
Exon 3 To Exon 4 (Pair 42)
Forward (316,22)TGACCTTCAGATGGATATCGTCAmplicon SizecDNA: 143 bpgenomic: 105,762
Reverse (458,21)TCACATGAGGAGCTGCATGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.172 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGC
TCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGA
GATCCATGCAGCTCCTCATGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)143231 - 373
NM_006157 (NELL1)143231 - 373
Exon 3 To Exon 4 (Pair 43)
Forward (368,20)GGAGTTGCTCAGGTGTCTGGAmplicon SizecDNA: 86 bpgenomic: 105,705
Reverse (453,21)TGAGGAGCTGCATGGATCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.07 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.179 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATA
GAAAGAGAGATCCATGCAGCTCCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)86283 - 368
NM_006157 (NELL1)86283 - 368
Exon 3 To Exon 4 (Pair 44)
Forward (316,22)TGACCTTCAGATGGATATCGTCAmplicon SizecDNA: 135 bpgenomic: 105,754
Reverse (450,21)GGAGCTGCATGGATCTCTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops2.008 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGC
TCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGA
GATCCATGCAGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)135231 - 365
NM_006157 (NELL1)135231 - 365
Exon 3 To Exon 4 (Pair 45)
Forward (312,22)ACCCTGACCTTCAGATGGATATAmplicon SizecDNA: 139 bpgenomic: 105,758
Reverse (450,21)GGAGCTGCATGGATCTCTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.246 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops2.008 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAG
TTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)139227 - 365
NM_006157 (NELL1)139227 - 365
Exon 3 To Exon 4 (Pair 46)
Forward (372,21)TTGCTCAGGTGTCTGGAATGCAmplicon SizecDNA: 196 bpgenomic: 105,815
Reverse (567,22)TCCAGTTCTCGAATGGACAGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-0.052 kcal/mol
Reverse Loops0.189 kcal/mol
Reverse Dimers-1.613 kcal/mol
Forward-Reverse Dimers-2.336 kcal/mol
Amplicon Folding-2.374 kcal/mol outside primersite
Amplicon SequenceTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCCTCATGTGAGTGAGAAATTAATTCAGCTGTTCCGGAACAAGA
GTGAATTCACCATTTTGGCCACTGTACAGCAGAAGCCATCCACTTCAGGAGTGATACTGT
CCATTCGAGAACTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)196287 - 482
NM_006157 (NELL1)196287 - 482
Exon 3 To Exon 4 (Pair 47)
Forward (365,21)CTTGGAGTTGCTCAGGTGTCTAmplicon SizecDNA: 87 bpgenomic: 105,706
Reverse (451,21)AGGAGCTGCATGGATCTCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.458 kcal/mol
Forward Dimers-0.293 kcal/mol
Reverse Loops1.991 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.179 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceCTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGAC
ATAGAAAGAGAGATCCATGCAGCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)87280 - 366
NM_006157 (NELL1)87280 - 366
Exon 3 To Exon 4 (Pair 48)
Forward (315,22)CTGACCTTCAGATGGATATCGTAmplicon SizecDNA: 134 bpgenomic: 105,753
Reverse (448,22)AGCTGCATGGATCTCTCTTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.457 kcal/mol
Forward Dimers-1.015 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.65 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTG
CTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAG
AGATCCATGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)134230 - 363
NM_006157 (NELL1)134230 - 363
Exon 3 To Exon 4 (Pair 49)
Forward (317,22)GACCTTCAGATGGATATCGTCAAmplicon SizecDNA: 129 bpgenomic: 105,748
Reverse (445,23)TGCATGGATCTCTCTTTCTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops2.336 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCT
CAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAG
ATCCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)129232 - 360
NM_006157 (NELL1)129232 - 360
Exon 3 To Exon 4 (Pair 50)
Forward (331,21)TATCGTCACCGAGCTTGACCTAmplicon SizecDNA: 117 bpgenomic: 105,736
Reverse (447,22)GCTGCATGGATCTCTCTTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.519 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceTATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTCAGGTGTCTGGAAT
GCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGATCCATGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)117246 - 362
NM_006157 (NELL1)117246 - 362
Exon 3 To Exon 4 (Pair 51)
Forward (372,21)TTGCTCAGGTGTCTGGAATGCAmplicon SizecDNA: 89 bpgenomic: 105,708
Reverse (460,21)ACTCACATGAGGAGCTGCATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-0.052 kcal/mol
Reverse Loops0.928 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.683 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCCTCATGTGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)89287 - 375
NM_006157 (NELL1)89287 - 375
Exon 3 To Exon 4 (Pair 52)
Forward (368,20)GGAGTTGCTCAGGTGTCTGGAmplicon SizecDNA: 83 bpgenomic: 105,702
Reverse (450,21)GGAGCTGCATGGATCTCTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.07 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops2.008 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.179 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATA
GAAAGAGAGATCCATGCAGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)83283 - 365
NM_006157 (NELL1)83283 - 365
Exon 3 To Exon 4 (Pair 53)
Forward (311,21)GACCCTGACCTTCAGATGGATAmplicon SizecDNA: 148 bpgenomic: 105,767
Reverse (458,21)TCACATGAGGAGCTGCATGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.246 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.172 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGA
GTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAA
AGAGAGATCCATGCAGCTCCTCATGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)148226 - 373
NM_006157 (NELL1)148226 - 373
Exon 3 To Exon 4 (Pair 54)
Forward (312,22)ACCCTGACCTTCAGATGGATATAmplicon SizecDNA: 134 bpgenomic: 105,753
Reverse (445,23)TGCATGGATCTCTCTTTCTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.246 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops2.336 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAG
TTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)134227 - 360
NM_006157 (NELL1)134227 - 360
Exon 3 To Exon 4 (Pair 55)
Forward (365,21)CTTGGAGTTGCTCAGGTGTCTAmplicon SizecDNA: 89 bpgenomic: 105,708
Reverse (453,21)TGAGGAGCTGCATGGATCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.458 kcal/mol
Forward Dimers-0.293 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceCTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGAC
ATAGAAAGAGAGATCCATGCAGCTCCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)89280 - 368
NM_006157 (NELL1)89280 - 368
Exon 3 To Exon 4 (Pair 56)
Forward (366,21)TTGGAGTTGCTCAGGTGTCTGAmplicon SizecDNA: 83 bpgenomic: 105,702
Reverse (448,22)AGCTGCATGGATCTCTCTTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.65 kcal/mol
Forward-Reverse Dimers-1.339 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACA
TAGAAAGAGAGATCCATGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)83281 - 363
NM_006157 (NELL1)83281 - 363
Exon 3 To Exon 4 (Pair 57)
Forward (317,22)GACCTTCAGATGGATATCGTCAAmplicon SizecDNA: 139 bpgenomic: 105,758
Reverse (455,21)CATGAGGAGCTGCATGGATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.714 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCT
CAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAG
ATCCATGCAGCTCCTCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)139232 - 370
NM_006157 (NELL1)139232 - 370
Exon 3 To Exon 4 (Pair 58)
Forward (318,22)ACCTTCAGATGGATATCGTCACAmplicon SizecDNA: 143 bpgenomic: 105,762
Reverse (460,21)ACTCACATGAGGAGCTGCATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops0.928 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTC
AGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGA
TCCATGCAGCTCCTCATGTGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)143233 - 375
NM_006157 (NELL1)143233 - 375
Exon 3 To Exon 4 (Pair 59)
Forward (315,22)CTGACCTTCAGATGGATATCGTAmplicon SizecDNA: 133 bpgenomic: 105,752
Reverse (447,22)GCTGCATGGATCTCTCTTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.457 kcal/mol
Forward Dimers-1.015 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTG
CTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAG
AGATCCATGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)133230 - 362
NM_006157 (NELL1)133230 - 362
Exon 3 To Exon 4 (Pair 60)
Forward (306,20)GGATGGACCCTGACCTTCAGAmplicon SizecDNA: 143 bpgenomic: 105,762
Reverse (448,22)AGCTGCATGGATCTCTCTTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.057 kcal/mol in 3' area
Forward Dimers-0.566 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.65 kcal/mol
Forward-Reverse Dimers-1.025 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGGATGGACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCC
TTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACA
TAGAAAGAGAGATCCATGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)143221 - 363
NM_006157 (NELL1)143221 - 363
Exon 3 To Exon 4 (Pair 61)
Forward (365,21)CTTGGAGTTGCTCAGGTGTCTAmplicon SizecDNA: 202 bpgenomic: 105,821
Reverse (566,22)CCAGTTCTCGAATGGACAGTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.458 kcal/mol
Forward Dimers-0.293 kcal/mol
Reverse Loops0.494 kcal/mol
Reverse Dimers-1.308 kcal/mol
Forward-Reverse Dimers-1.124 kcal/mol
Amplicon Folding-2.374 kcal/mol outside primersite
Amplicon SequenceCTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGAC
ATAGAAAGAGAGATCCATGCAGCTCCTCATGTGAGTGAGAAATTAATTCAGCTGTTCCGG
AACAAGAGTGAATTCACCATTTTGGCCACTGTACAGCAGAAGCCATCCACTTCAGGAGTG
ATACTGTCCATTCGAGAACTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)202280 - 481
NM_006157 (NELL1)202280 - 481
Exon 3 To Exon 4 (Pair 62)
Forward (316,22)TGACCTTCAGATGGATATCGTCAmplicon SizecDNA: 133 bpgenomic: 105,752
Reverse (448,22)AGCTGCATGGATCTCTCTTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.65 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGC
TCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGA
GATCCATGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)133231 - 363
NM_006157 (NELL1)133231 - 363
Exon 3 To Exon 4 (Pair 63)
Forward (316,22)TGACCTTCAGATGGATATCGTCAmplicon SizecDNA: 140 bpgenomic: 105,759
Reverse (455,21)CATGAGGAGCTGCATGGATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.714 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGC
TCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGA
GATCCATGCAGCTCCTCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)140231 - 370
NM_006157 (NELL1)140231 - 370
Exon 3 To Exon 4 (Pair 64)
Forward (368,20)GGAGTTGCTCAGGTGTCTGGAmplicon SizecDNA: 81 bpgenomic: 105,700
Reverse (448,22)AGCTGCATGGATCTCTCTTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.07 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.65 kcal/mol
Forward-Reverse Dimers-1.339 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATA
GAAAGAGAGATCCATGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)81283 - 363
NM_006157 (NELL1)81283 - 363
Exon 3 To Exon 4 (Pair 65)
Forward (372,21)TTGCTCAGGTGTCTGGAATGCAmplicon SizecDNA: 87 bpgenomic: 105,706
Reverse (458,21)TCACATGAGGAGCTGCATGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-0.052 kcal/mol
Reverse Loops1.172 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.683 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCCTCATGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)87287 - 373
NM_006157 (NELL1)87287 - 373
Exon 3 To Exon 4 (Pair 66)
Forward (372,21)TTGCTCAGGTGTCTGGAATGCAmplicon SizecDNA: 79 bpgenomic: 105,698
Reverse (450,21)GGAGCTGCATGGATCTCTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-0.052 kcal/mol
Reverse Loops2.008 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.179 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)79287 - 365
NM_006157 (NELL1)79287 - 365
Exon 3 To Exon 4 (Pair 67)
Forward (317,22)GACCTTCAGATGGATATCGTCAAmplicon SizecDNA: 134 bpgenomic: 105,753
Reverse (450,21)GGAGCTGCATGGATCTCTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops2.008 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCT
CAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAG
ATCCATGCAGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)134232 - 365
NM_006157 (NELL1)134232 - 365
Exon 3 To Exon 4 (Pair 68)
Forward (315,22)CTGACCTTCAGATGGATATCGTAmplicon SizecDNA: 142 bpgenomic: 105,761
Reverse (456,21)ACATGAGGAGCTGCATGGATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.457 kcal/mol
Forward Dimers-1.015 kcal/mol
Reverse Loops1.172 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTG
CTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAG
AGATCCATGCAGCTCCTCATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)142230 - 371
NM_006157 (NELL1)142230 - 371
Exon 3 To Exon 4 (Pair 69)
Forward (336,21)TCACCGAGCTTGACCTTGTGAAmplicon SizecDNA: 113 bpgenomic: 105,732
Reverse (448,22)AGCTGCATGGATCTCTCTTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.486 kcal/mol in 3' area
Forward Dimers-2.948 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.65 kcal/mol
Forward-Reverse Dimers-2.736 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTCAGGTGTCTGGAATGCACA
ATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGATCCATGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)113251 - 363
NM_006157 (NELL1)113251 - 363
Exon 3 To Exon 4 (Pair 70)
Forward (312,22)ACCCTGACCTTCAGATGGATATAmplicon SizecDNA: 144 bpgenomic: 105,763
Reverse (455,21)CATGAGGAGCTGCATGGATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.246 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.714 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAG
TTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCCTCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)144227 - 370
NM_006157 (NELL1)144227 - 370
Exon 3 To Exon 4 (Pair 71)
Forward (334,20)CGTCACCGAGCTTGACCTTGAmplicon SizecDNA: 115 bpgenomic: 105,734
Reverse (448,22)AGCTGCATGGATCTCTCTTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.988 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.65 kcal/mol
Forward-Reverse Dimers-2.736 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTCAGGTGTCTGGAATGCA
CAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGATCCATGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)115249 - 363
NM_006157 (NELL1)115249 - 363
Exon 3 To Exon 4 (Pair 72)
Forward (368,20)GGAGTTGCTCAGGTGTCTGGAmplicon SizecDNA: 87 bpgenomic: 105,706
Reverse (454,21)ATGAGGAGCTGCATGGATCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.07 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.329 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATA
GAAAGAGAGATCCATGCAGCTCCTCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)87283 - 369
NM_006157 (NELL1)87283 - 369
Exon 3 To Exon 4 (Pair 73)
Forward (317,22)GACCTTCAGATGGATATCGTCAAmplicon SizecDNA: 144 bpgenomic: 105,763
Reverse (460,21)ACTCACATGAGGAGCTGCATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops0.928 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCT
CAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAG
ATCCATGCAGCTCCTCATGTGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)144232 - 375
NM_006157 (NELL1)144232 - 375
Exon 3 To Exon 4 (Pair 74)
Forward (318,22)ACCTTCAGATGGATATCGTCACAmplicon SizecDNA: 137 bpgenomic: 105,756
Reverse (454,21)ATGAGGAGCTGCATGGATCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTC
AGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGA
TCCATGCAGCTCCTCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)137233 - 369
NM_006157 (NELL1)137233 - 369
Exon 3 To Exon 4 (Pair 75)
Forward (366,21)TTGGAGTTGCTCAGGTGTCTGAmplicon SizecDNA: 82 bpgenomic: 105,701
Reverse (447,22)GCTGCATGGATCTCTCTTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACA
TAGAAAGAGAGATCCATGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)82281 - 362
NM_006157 (NELL1)82281 - 362
Exon 3 To Exon 4 (Pair 76)
Forward (315,22)CTGACCTTCAGATGGATATCGTAmplicon SizecDNA: 141 bpgenomic: 105,760
Reverse (455,21)CATGAGGAGCTGCATGGATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.457 kcal/mol
Forward Dimers-1.015 kcal/mol
Reverse Loops1.714 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTG
CTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAG
AGATCCATGCAGCTCCTCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)141230 - 370
NM_006157 (NELL1)141230 - 370
Exon 3 To Exon 4 (Pair 77)
Forward (366,21)TTGGAGTTGCTCAGGTGTCTGAmplicon SizecDNA: 86 bpgenomic: 105,705
Reverse (451,21)AGGAGCTGCATGGATCTCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops1.991 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.179 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACA
TAGAAAGAGAGATCCATGCAGCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)86281 - 366
NM_006157 (NELL1)86281 - 366
Exon 3 To Exon 4 (Pair 78)
Forward (318,22)ACCTTCAGATGGATATCGTCACAmplicon SizecDNA: 136 bpgenomic: 105,755
Reverse (453,21)TGAGGAGCTGCATGGATCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTC
AGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGA
TCCATGCAGCTCCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)136233 - 368
NM_006157 (NELL1)136233 - 368
Exon 3 To Exon 4 (Pair 79)
Forward (312,22)ACCCTGACCTTCAGATGGATATAmplicon SizecDNA: 145 bpgenomic: 105,764
Reverse (456,21)ACATGAGGAGCTGCATGGATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.246 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.172 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAG
TTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCCTCATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)145227 - 371
NM_006157 (NELL1)145227 - 371
Exon 3 To Exon 4 (Pair 80)
Forward (311,21)GACCCTGACCTTCAGATGGATAmplicon SizecDNA: 145 bpgenomic: 105,764
Reverse (455,21)CATGAGGAGCTGCATGGATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.246 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.714 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGA
GTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAA
AGAGAGATCCATGCAGCTCCTCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)145226 - 370
NM_006157 (NELL1)145226 - 370
Exon 3 To Exon 4 (Pair 81)
Forward (336,21)TCACCGAGCTTGACCTTGTGAAmplicon SizecDNA: 112 bpgenomic: 105,731
Reverse (447,22)GCTGCATGGATCTCTCTTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.486 kcal/mol in 3' area
Forward Dimers-2.948 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.519 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTCAGGTGTCTGGAATGCACA
ATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGATCCATGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)112251 - 362
NM_006157 (NELL1)112251 - 362
Exon 3 To Exon 4 (Pair 82)
Forward (318,22)ACCTTCAGATGGATATCGTCACAmplicon SizecDNA: 128 bpgenomic: 105,747
Reverse (445,23)TGCATGGATCTCTCTTTCTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops2.336 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTC
AGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGA
TCCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)128233 - 360
NM_006157 (NELL1)128233 - 360
Exon 3 To Exon 4 (Pair 83)
Forward (365,21)CTTGGAGTTGCTCAGGTGTCTAmplicon SizecDNA: 208 bpgenomic: 105,827
Reverse (572,21)TGTGCTCCAGTTCTCGAATGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.458 kcal/mol
Forward Dimers-0.293 kcal/mol
Reverse Loops1 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.443 kcal/mol
Amplicon Folding-2.374 kcal/mol outside primersite
Amplicon SequenceCTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGAC
ATAGAAAGAGAGATCCATGCAGCTCCTCATGTGAGTGAGAAATTAATTCAGCTGTTCCGG
AACAAGAGTGAATTCACCATTTTGGCCACTGTACAGCAGAAGCCATCCACTTCAGGAGTG
ATACTGTCCATTCGAGAACTGGAGCACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)208280 - 487
NM_006157 (NELL1)208280 - 487
Exon 3 To Exon 4 (Pair 84)
Forward (316,22)TGACCTTCAGATGGATATCGTCAmplicon SizecDNA: 139 bpgenomic: 105,758
Reverse (454,21)ATGAGGAGCTGCATGGATCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGC
TCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGA
GATCCATGCAGCTCCTCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)139231 - 369
NM_006157 (NELL1)139231 - 369
Exon 3 To Exon 4 (Pair 85)
Forward (312,22)ACCCTGACCTTCAGATGGATATAmplicon SizecDNA: 142 bpgenomic: 105,761
Reverse (453,21)TGAGGAGCTGCATGGATCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.246 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAG
TTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)142227 - 368
NM_006157 (NELL1)142227 - 368
Exon 3 To Exon 4 (Pair 86)
Forward (318,22)ACCTTCAGATGGATATCGTCACAmplicon SizecDNA: 139 bpgenomic: 105,758
Reverse (456,21)ACATGAGGAGCTGCATGGATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.172 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTC
AGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGA
TCCATGCAGCTCCTCATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)139233 - 371
NM_006157 (NELL1)139233 - 371
Exon 3 To Exon 4 (Pair 87)
Forward (330,21)ATATCGTCACCGAGCTTGACCAmplicon SizecDNA: 116 bpgenomic: 105,735
Reverse (445,23)TGCATGGATCTCTCTTTCTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops2.336 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.127 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTCAGGTGTCTGGAA
TGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGATCCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)116245 - 360
NM_006157 (NELL1)116245 - 360
Exon 3 To Exon 4 (Pair 88)
Forward (372,21)TTGCTCAGGTGTCTGGAATGCAmplicon SizecDNA: 82 bpgenomic: 105,701
Reverse (453,21)TGAGGAGCTGCATGGATCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-0.052 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.179 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)82287 - 368
NM_006157 (NELL1)82287 - 368
Exon 3 To Exon 4 (Pair 89)
Forward (365,21)CTTGGAGTTGCTCAGGTGTCTAmplicon SizecDNA: 86 bpgenomic: 105,705
Reverse (450,21)GGAGCTGCATGGATCTCTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.458 kcal/mol
Forward Dimers-0.293 kcal/mol
Reverse Loops2.008 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.179 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceCTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGAC
ATAGAAAGAGAGATCCATGCAGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)86280 - 365
NM_006157 (NELL1)86280 - 365
Exon 3 To Exon 4 (Pair 90)
Forward (317,22)GACCTTCAGATGGATATCGTCAAmplicon SizecDNA: 138 bpgenomic: 105,757
Reverse (454,21)ATGAGGAGCTGCATGGATCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCT
CAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAG
ATCCATGCAGCTCCTCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)138232 - 369
NM_006157 (NELL1)138232 - 369
Exon 3 To Exon 4 (Pair 91)
Forward (316,22)TGACCTTCAGATGGATATCGTCAmplicon SizecDNA: 145 bpgenomic: 105,764
Reverse (460,21)ACTCACATGAGGAGCTGCATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops0.928 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGC
TCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGA
GATCCATGCAGCTCCTCATGTGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)145231 - 375
NM_006157 (NELL1)145231 - 375
Exon 3 To Exon 4 (Pair 92)
Forward (366,21)TTGGAGTTGCTCAGGTGTCTGAmplicon SizecDNA: 201 bpgenomic: 105,820
Reverse (566,22)CCAGTTCTCGAATGGACAGTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops0.494 kcal/mol
Reverse Dimers-1.308 kcal/mol
Forward-Reverse Dimers-1.124 kcal/mol
Amplicon Folding-2.374 kcal/mol outside primersite
Amplicon SequenceTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACA
TAGAAAGAGAGATCCATGCAGCTCCTCATGTGAGTGAGAAATTAATTCAGCTGTTCCGGA
ACAAGAGTGAATTCACCATTTTGGCCACTGTACAGCAGAAGCCATCCACTTCAGGAGTGA
TACTGTCCATTCGAGAACTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)201281 - 481
NM_006157 (NELL1)201281 - 481
Exon 3 To Exon 4 (Pair 93)
Forward (366,21)TTGGAGTTGCTCAGGTGTCTGAmplicon SizecDNA: 80 bpgenomic: 105,699
Reverse (445,23)TGCATGGATCTCTCTTTCTATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol in 3' area
Forward Dimers-0.293 kcal/mol
Reverse Loops2.336 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACA
TAGAAAGAGAGATCCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)80281 - 360
NM_006157 (NELL1)80281 - 360
Exon 3 To Exon 4 (Pair 94)
Forward (332,21)ATCGTCACCGAGCTTGACCTTAmplicon SizecDNA: 117 bpgenomic: 105,736
Reverse (448,22)AGCTGCATGGATCTCTCTTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.65 kcal/mol
Forward-Reverse Dimers-2.736 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTCAGGTGTCTGGAATG
CACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGATCCATGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)117247 - 363
NM_006157 (NELL1)117247 - 363
Exon 3 To Exon 4 (Pair 95)
Forward (365,21)CTTGGAGTTGCTCAGGTGTCTAmplicon SizecDNA: 203 bpgenomic: 105,822
Reverse (567,22)TCCAGTTCTCGAATGGACAGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.458 kcal/mol
Forward Dimers-0.293 kcal/mol
Reverse Loops0.189 kcal/mol
Reverse Dimers-1.613 kcal/mol
Forward-Reverse Dimers-1.429 kcal/mol
Amplicon Folding-2.374 kcal/mol outside primersite
Amplicon SequenceCTTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGAC
ATAGAAAGAGAGATCCATGCAGCTCCTCATGTGAGTGAGAAATTAATTCAGCTGTTCCGG
AACAAGAGTGAATTCACCATTTTGGCCACTGTACAGCAGAAGCCATCCACTTCAGGAGTG
ATACTGTCCATTCGAGAACTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)203280 - 482
NM_006157 (NELL1)203280 - 482
Exon 3 To Exon 4 (Pair 96)
Forward (334,20)CGTCACCGAGCTTGACCTTGAmplicon SizecDNA: 114 bpgenomic: 105,733
Reverse (447,22)GCTGCATGGATCTCTCTTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.988 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.519 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTCAGGTGTCTGGAATGCA
CAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGATCCATGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)114249 - 362
NM_006157 (NELL1)114249 - 362
Exon 3 To Exon 4 (Pair 97)
Forward (372,21)TTGCTCAGGTGTCTGGAATGCAmplicon SizecDNA: 86 bpgenomic: 105,705
Reverse (457,21)CACATGAGGAGCTGCATGGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-0.052 kcal/mol
Reverse Loops1.172 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.446 kcal/mol
Amplicon Folding-0.483 kcal/mol outside primersite
Amplicon SequenceTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAA
GAGAGATCCATGCAGCTCCTCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)86287 - 372
NM_006157 (NELL1)86287 - 372
Exon 3 To Exon 4 (Pair 98)
Forward (306,20)GGATGGACCCTGACCTTCAGAmplicon SizecDNA: 142 bpgenomic: 105,761
Reverse (447,22)GCTGCATGGATCTCTCTTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.057 kcal/mol in 3' area
Forward Dimers-0.566 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.025 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceGGATGGACCCTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCC
TTGGAGTTGCTCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACA
TAGAAAGAGAGATCCATGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)142221 - 362
NM_006157 (NELL1)142221 - 362
Exon 3 To Exon 4 (Pair 99)
Forward (318,22)ACCTTCAGATGGATATCGTCACAmplicon SizecDNA: 140 bpgenomic: 105,759
Reverse (457,21)CACATGAGGAGCTGCATGGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops1.172 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGCTC
AGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGAGA
TCCATGCAGCTCCTCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)140233 - 372
NM_006157 (NELL1)140233 - 372
Exon 3 To Exon 4 (Pair 100)
Forward (316,22)TGACCTTCAGATGGATATCGTCAmplicon SizecDNA: 132 bpgenomic: 105,751
Reverse (447,22)GCTGCATGGATCTCTCTTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.654 kcal/mol
Reverse Loops2.093 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.232 kcal/mol outside primersite
Amplicon SequenceTGACCTTCAGATGGATATCGTCACCGAGCTTGACCTTGTGAACACCACCCTTGGAGTTGC
TCAGGTGTCTGGAATGCACAATGCCAGCAAAGCATTTTTATTTCAAGACATAGAAAGAGA
GATCCATGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201551 (NELL1)132231 - 362
NM_006157 (NELL1)132231 - 362
 

See below for some more details.

Program Output:

Loading ...