Design Results for pax2

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 5 To Exon 6 (Pair 1)
Forward (1135,22)CTCCAATGGTGAGAAGAGGAAAAmplicon SizecDNA: 93 bpgenomic: 5,670
Reverse (1227,21)GTCCAGACCAGATGCAAACCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.487 kcal/mol
Forward Dimers-1.338 kcal/mol
Reverse Loops2.131 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.493 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACAT
TAGAGGAGGTGGAGGTTTGCATCTGGTCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)931135 - 1227
NM_003987 (PAX2)931135 - 1227
Exon 5 To Exon 7 (Pair 1)
Forward (1143,22)GTGAGAAGAGGAAACGTGATGAAmplicon SizecDNA: 135 bpgenomic: 25,130
Reverse (1277,21)CACTCTGGGAATCTCCATTGGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops0.853 kcal/mol
Reverse Dimers-0.619 kcal/mol
Forward-Reverse Dimers-1.913 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAG
GTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATG
GAGATTCCCAGAGTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1351143 - 1277
NM_003989 (PAX2)661143 - 1208
NM_003987 (PAX2)1351143 - 1277
NM_003988 (PAX2)661143 - 1208
NM_000278 (PAX2)661143 - 1208
Exon 5 To Exon 7 (Pair 2)
Forward (1143,22)GTGAGAAGAGGAAACGTGATGAAmplicon SizecDNA: 187 bpgenomic: 25,182
Reverse (1329,20)TGCTGCTGGGTGAAGGTGTCNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops1.997 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.244 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAG
GTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATG
GAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCC
AGCAGCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1871143 - 1329
NM_003989 (PAX2)1181143 - 1260
NM_003987 (PAX2)1871143 - 1329
NM_003988 (PAX2)1181143 - 1260
NM_000278 (PAX2)1181143 - 1260
Exon 5 To Exon 7 (Pair 3)
Forward (1145,22)GAGAAGAGGAAACGTGATGAAGAmplicon SizecDNA: 136 bpgenomic: 25,131
Reverse (1280,21)CACCACTCTGGGAATCTCCATNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-1.913 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGT
GGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGA
GATTCCCAGAGTGGTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1361145 - 1280
NM_003989 (PAX2)671145 - 1211
NM_003987 (PAX2)1361145 - 1280
NM_003988 (PAX2)671145 - 1211
NM_000278 (PAX2)671145 - 1211
Exon 5 To Exon 7 (Pair 4)
Forward (1129,21)TCCTCGCTCCAATGGTGAGAAAmplicon SizecDNA: 200 bpgenomic: 25,195
Reverse (1328,20)GCTGCTGGGTGAAGGTGTCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.293 kcal/mol in 3' area
Forward Dimers-1.338 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.495 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceTCCTCGCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGC
CCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGG
CTCAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGC
TGACACCTTCACCCAGCAGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)2001129 - 1328
NM_003989 (PAX2)1311129 - 1259
NM_003987 (PAX2)2001129 - 1328
NM_003988 (PAX2)1311129 - 1259
NM_000278 (PAX2)1311129 - 1259
Exon 5 To Exon 7 (Pair 5)
Forward (1145,22)GAGAAGAGGAAACGTGATGAAGAmplicon SizecDNA: 133 bpgenomic: 25,128
Reverse (1277,21)CACTCTGGGAATCTCCATTGGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops0.853 kcal/mol
Reverse Dimers-0.619 kcal/mol
Forward-Reverse Dimers-1.913 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGT
GGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGA
GATTCCCAGAGTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1331145 - 1277
NM_003989 (PAX2)641145 - 1208
NM_003987 (PAX2)1331145 - 1277
NM_003988 (PAX2)641145 - 1208
NM_000278 (PAX2)641145 - 1208
Exon 5 To Exon 7 (Pair 6)
Forward (1136,22)TCCAATGGTGAGAAGAGGAAACAmplicon SizecDNA: 195 bpgenomic: 25,190
Reverse (1330,20)CTGCTGCTGGGTGAAGGTGTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.487 kcal/mol
Forward Dimers-1.338 kcal/mol
Reverse Loops2.48 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.244 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATT
AGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTC
CCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACC
TTCACCCAGCAGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1951136 - 1330
NM_003989 (PAX2)1261136 - 1261
NM_003987 (PAX2)1951136 - 1330
NM_003988 (PAX2)1261136 - 1261
NM_000278 (PAX2)1261136 - 1261
Exon 5 To Exon 7 (Pair 7)
Forward (1143,22)GTGAGAAGAGGAAACGTGATGAAmplicon SizecDNA: 142 bpgenomic: 25,137
Reverse (1284,21)TCCACACCACTCTGGGAATCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-1.913 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAG
GTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATG
GAGATTCCCAGAGTGGTGTGGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1421143 - 1284
NM_003989 (PAX2)731143 - 1215
NM_003987 (PAX2)1421143 - 1284
NM_003988 (PAX2)731143 - 1215
NM_000278 (PAX2)731143 - 1215
Exon 5 To Exon 6 (Pair 2)
Forward (1131,21)CTCGCTCCAATGGTGAGAAGAAmplicon SizecDNA: 97 bpgenomic: 5,674
Reverse (1227,21)GTCCAGACCAGATGCAAACCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol in 3' area
Forward Dimers-1.338 kcal/mol
Reverse Loops2.131 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.493 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceCTCGCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCC
ACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)971131 - 1227
NM_003987 (PAX2)971131 - 1227
Exon 5 To Exon 6 (Pair 3)
Forward (1132,21)TCGCTCCAATGGTGAGAAGAGAmplicon SizecDNA: 96 bpgenomic: 5,673
Reverse (1227,21)GTCCAGACCAGATGCAAACCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.361 kcal/mol
Forward Dimers-1.338 kcal/mol
Reverse Loops2.131 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.493 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceTCGCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCA
CATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)961132 - 1227
NM_003987 (PAX2)961132 - 1227
Exon 5 To Exon 7 (Pair 8)
Forward (1145,22)GAGAAGAGGAAACGTGATGAAGAmplicon SizecDNA: 137 bpgenomic: 25,132
Reverse (1281,21)ACACCACTCTGGGAATCTCCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-1.913 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGT
GGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGA
GATTCCCAGAGTGGTGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1371145 - 1281
NM_003989 (PAX2)681145 - 1212
NM_003987 (PAX2)1371145 - 1281
NM_003988 (PAX2)681145 - 1212
NM_000278 (PAX2)681145 - 1212
Exon 5 To Exon 6 (Pair 4)
Forward (1134,21)GCTCCAATGGTGAGAAGAGGAAmplicon SizecDNA: 94 bpgenomic: 5,671
Reverse (1227,21)GTCCAGACCAGATGCAAACCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.361 kcal/mol
Forward Dimers-1.338 kcal/mol
Reverse Loops2.131 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.493 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACA
TTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)941134 - 1227
NM_003987 (PAX2)941134 - 1227
Exon 5 To Exon 7 (Pair 9)
Forward (1128,21)TTCCTCGCTCCAATGGTGAGAAmplicon SizecDNA: 200 bpgenomic: 25,195
Reverse (1327,20)CTGCTGGGTGAAGGTGTCAGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.293 kcal/mol in 3' area
Forward Dimers-1.338 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers0.056 kcal/mol in 3' area
Forward-Reverse Dimers-1.495 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceTTCCTCGCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTG
CCCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGG
GCTCAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAG
CTGACACCTTCACCCAGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)2001128 - 1327
NM_003989 (PAX2)1311128 - 1258
NM_003987 (PAX2)2001128 - 1327
NM_003988 (PAX2)1311128 - 1258
NM_000278 (PAX2)1311128 - 1258
Exon 5 To Exon 7 (Pair 10)
Forward (1128,21)TTCCTCGCTCCAATGGTGAGAAmplicon SizecDNA: 201 bpgenomic: 25,196
Reverse (1328,20)GCTGCTGGGTGAAGGTGTCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.293 kcal/mol in 3' area
Forward Dimers-1.338 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.495 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceTTCCTCGCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTG
CCCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGG
GCTCAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAG
CTGACACCTTCACCCAGCAGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)2011128 - 1328
NM_003989 (PAX2)1321128 - 1259
NM_003987 (PAX2)2011128 - 1328
NM_003988 (PAX2)1321128 - 1259
NM_000278 (PAX2)1321128 - 1259
Exon 5 To Exon 7 (Pair 11)
Forward (1134,21)GCTCCAATGGTGAGAAGAGGAAmplicon SizecDNA: 194 bpgenomic: 25,189
Reverse (1327,20)CTGCTGGGTGAAGGTGTCAGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.361 kcal/mol
Forward Dimers-1.338 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers0.056 kcal/mol in 3' area
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceGCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACA
TTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAG
TCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACA
CCTTCACCCAGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1941134 - 1327
NM_003989 (PAX2)1251134 - 1258
NM_003987 (PAX2)1941134 - 1327
NM_003988 (PAX2)1251134 - 1258
NM_000278 (PAX2)1251134 - 1258
Exon 5 To Exon 7 (Pair 12)
Forward (1145,22)GAGAAGAGGAAACGTGATGAAGAmplicon SizecDNA: 140 bpgenomic: 25,135
Reverse (1284,21)TCCACACCACTCTGGGAATCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-1.913 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGT
GGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGA
GATTCCCAGAGTGGTGTGGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1401145 - 1284
NM_003989 (PAX2)711145 - 1215
NM_003987 (PAX2)1401145 - 1284
NM_003988 (PAX2)711145 - 1215
NM_000278 (PAX2)711145 - 1215
Exon 5 To Exon 7 (Pair 13)
Forward (1136,22)TCCAATGGTGAGAAGAGGAAACAmplicon SizecDNA: 194 bpgenomic: 25,189
Reverse (1329,20)TGCTGCTGGGTGAAGGTGTCNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.487 kcal/mol
Forward Dimers-1.338 kcal/mol
Reverse Loops1.997 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.244 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATT
AGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTC
CCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACC
TTCACCCAGCAGCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1941136 - 1329
NM_003989 (PAX2)1251136 - 1260
NM_003987 (PAX2)1941136 - 1329
NM_003988 (PAX2)1251136 - 1260
NM_000278 (PAX2)1251136 - 1260
Exon 5 To Exon 7 (Pair 14)
Forward (1135,22)CTCCAATGGTGAGAAGAGGAAAAmplicon SizecDNA: 195 bpgenomic: 25,190
Reverse (1329,20)TGCTGCTGGGTGAAGGTGTCNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.487 kcal/mol
Forward Dimers-1.338 kcal/mol
Reverse Loops1.997 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.244 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACAT
TAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGT
CCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACAC
CTTCACCCAGCAGCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1951135 - 1329
NM_003989 (PAX2)1261135 - 1260
NM_003987 (PAX2)1951135 - 1329
NM_003988 (PAX2)1261135 - 1260
NM_000278 (PAX2)1261135 - 1260
Exon 5 To Exon 7 (Pair 15)
Forward (1143,22)GTGAGAAGAGGAAACGTGATGAAmplicon SizecDNA: 186 bpgenomic: 25,181
Reverse (1328,20)GCTGCTGGGTGAAGGTGTCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.244 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAG
GTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATG
GAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCC
AGCAGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1861143 - 1328
NM_003989 (PAX2)1171143 - 1259
NM_003987 (PAX2)1861143 - 1328
NM_003988 (PAX2)1171143 - 1259
NM_000278 (PAX2)1171143 - 1259
Exon 5 To Exon 7 (Pair 16)
Forward (1135,22)CTCCAATGGTGAGAAGAGGAAAAmplicon SizecDNA: 196 bpgenomic: 25,191
Reverse (1330,20)CTGCTGCTGGGTGAAGGTGTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.487 kcal/mol
Forward Dimers-1.338 kcal/mol
Reverse Loops2.48 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.244 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACAT
TAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGT
CCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACAC
CTTCACCCAGCAGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1961135 - 1330
NM_003989 (PAX2)1271135 - 1261
NM_003987 (PAX2)1961135 - 1330
NM_003988 (PAX2)1271135 - 1261
NM_000278 (PAX2)1271135 - 1261
Exon 5 To Exon 7 (Pair 17)
Forward (1145,22)GAGAAGAGGAAACGTGATGAAGAmplicon SizecDNA: 184 bpgenomic: 25,179
Reverse (1328,20)GCTGCTGGGTGAAGGTGTCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.244 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGT
GGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGA
GATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAG
CAGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1841145 - 1328
NM_003989 (PAX2)1151145 - 1259
NM_003987 (PAX2)1841145 - 1328
NM_003988 (PAX2)1151145 - 1259
NM_000278 (PAX2)1151145 - 1259
Exon 5 To Exon 7 (Pair 18)
Forward (1145,22)GAGAAGAGGAAACGTGATGAAGAmplicon SizecDNA: 186 bpgenomic: 25,181
Reverse (1330,20)CTGCTGCTGGGTGAAGGTGTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops2.48 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.244 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGT
GGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGA
GATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAG
CAGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1861145 - 1330
NM_003989 (PAX2)1171145 - 1261
NM_003987 (PAX2)1861145 - 1330
NM_003988 (PAX2)1171145 - 1261
NM_000278 (PAX2)1171145 - 1261
Exon 5 To Exon 7 (Pair 19)
Forward (1143,22)GTGAGAAGAGGAAACGTGATGAAmplicon SizecDNA: 138 bpgenomic: 25,133
Reverse (1280,21)CACCACTCTGGGAATCTCCATNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-1.913 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAG
GTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATG
GAGATTCCCAGAGTGGTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1381143 - 1280
NM_003989 (PAX2)691143 - 1211
NM_003987 (PAX2)1381143 - 1280
NM_003988 (PAX2)691143 - 1211
NM_000278 (PAX2)691143 - 1211
Exon 5 To Exon 7 (Pair 20)
Forward (1136,22)TCCAATGGTGAGAAGAGGAAACAmplicon SizecDNA: 193 bpgenomic: 25,188
Reverse (1328,20)GCTGCTGGGTGAAGGTGTCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.487 kcal/mol
Forward Dimers-1.338 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.244 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATT
AGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTC
CCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACC
TTCACCCAGCAGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1931136 - 1328
NM_003989 (PAX2)1241136 - 1259
NM_003987 (PAX2)1931136 - 1328
NM_003988 (PAX2)1241136 - 1259
NM_000278 (PAX2)1241136 - 1259
Exon 5 To Exon 7 (Pair 21)
Forward (1143,22)GTGAGAAGAGGAAACGTGATGAAmplicon SizecDNA: 185 bpgenomic: 25,180
Reverse (1327,20)CTGCTGGGTGAAGGTGTCAGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers0.056 kcal/mol in 3' area
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAG
GTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATG
GAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCC
AGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1851143 - 1327
NM_003989 (PAX2)1161143 - 1258
NM_003987 (PAX2)1851143 - 1327
NM_003988 (PAX2)1161143 - 1258
NM_000278 (PAX2)1161143 - 1258
Exon 5 To Exon 7 (Pair 22)
Forward (1143,22)GTGAGAAGAGGAAACGTGATGAAmplicon SizecDNA: 139 bpgenomic: 25,134
Reverse (1281,21)ACACCACTCTGGGAATCTCCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-1.913 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAG
GTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATG
GAGATTCCCAGAGTGGTGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1391143 - 1281
NM_003989 (PAX2)701143 - 1212
NM_003987 (PAX2)1391143 - 1281
NM_003988 (PAX2)701143 - 1212
NM_000278 (PAX2)701143 - 1212
Exon 5 To Exon 7 (Pair 23)
Forward (1135,22)CTCCAATGGTGAGAAGAGGAAAAmplicon SizecDNA: 194 bpgenomic: 25,189
Reverse (1328,20)GCTGCTGGGTGAAGGTGTCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.487 kcal/mol
Forward Dimers-1.338 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.244 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACAT
TAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGT
CCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACAC
CTTCACCCAGCAGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1941135 - 1328
NM_003989 (PAX2)1251135 - 1259
NM_003987 (PAX2)1941135 - 1328
NM_003988 (PAX2)1251135 - 1259
NM_000278 (PAX2)1251135 - 1259
Exon 5 To Exon 7 (Pair 24)
Forward (1136,22)TCCAATGGTGAGAAGAGGAAACAmplicon SizecDNA: 192 bpgenomic: 25,187
Reverse (1327,20)CTGCTGGGTGAAGGTGTCAGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.487 kcal/mol
Forward Dimers-1.338 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers0.056 kcal/mol in 3' area
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATT
AGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTC
CCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACC
TTCACCCAGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1921136 - 1327
NM_003989 (PAX2)1231136 - 1258
NM_003987 (PAX2)1921136 - 1327
NM_003988 (PAX2)1231136 - 1258
NM_000278 (PAX2)1231136 - 1258
Exon 5 To Exon 7 (Pair 25)
Forward (1145,22)GAGAAGAGGAAACGTGATGAAGAmplicon SizecDNA: 185 bpgenomic: 25,180
Reverse (1329,20)TGCTGCTGGGTGAAGGTGTCNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops1.997 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.244 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGT
GGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGA
GATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAG
CAGCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1851145 - 1329
NM_003989 (PAX2)1161145 - 1260
NM_003987 (PAX2)1851145 - 1329
NM_003988 (PAX2)1161145 - 1260
NM_000278 (PAX2)1161145 - 1260
Exon 5 To Exon 7 (Pair 26)
Forward (1145,22)GAGAAGAGGAAACGTGATGAAGAmplicon SizecDNA: 183 bpgenomic: 25,178
Reverse (1327,20)CTGCTGGGTGAAGGTGTCAGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers0.056 kcal/mol in 3' area
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGT
GGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGA
GATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAG
CAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1831145 - 1327
NM_003989 (PAX2)1141145 - 1258
NM_003987 (PAX2)1831145 - 1327
NM_003988 (PAX2)1141145 - 1258
NM_000278 (PAX2)1141145 - 1258
Exon 5 To Exon 7 (Pair 27)
Forward (1135,22)CTCCAATGGTGAGAAGAGGAAAAmplicon SizecDNA: 193 bpgenomic: 25,188
Reverse (1327,20)CTGCTGGGTGAAGGTGTCAGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.487 kcal/mol
Forward Dimers-1.338 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers0.056 kcal/mol in 3' area
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACAT
TAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGT
CCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACAC
CTTCACCCAGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1931135 - 1327
NM_003989 (PAX2)1241135 - 1258
NM_003987 (PAX2)1931135 - 1327
NM_003988 (PAX2)1241135 - 1258
NM_000278 (PAX2)1241135 - 1258
Exon 5 To Exon 7 (Pair 28)
Forward (1132,21)TCGCTCCAATGGTGAGAAGAGAmplicon SizecDNA: 196 bpgenomic: 25,191
Reverse (1327,20)CTGCTGGGTGAAGGTGTCAGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.361 kcal/mol
Forward Dimers-1.338 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers0.056 kcal/mol in 3' area
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceTCGCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCA
CATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTC
AGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGA
CACCTTCACCCAGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1961132 - 1327
NM_003989 (PAX2)1271132 - 1258
NM_003987 (PAX2)1961132 - 1327
NM_003988 (PAX2)1271132 - 1258
NM_000278 (PAX2)1271132 - 1258
Exon 5 To Exon 6 (Pair 5)
Forward (1129,21)TCCTCGCTCCAATGGTGAGAAAmplicon SizecDNA: 99 bpgenomic: 5,676
Reverse (1227,21)GTCCAGACCAGATGCAAACCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.293 kcal/mol in 3' area
Forward Dimers-1.338 kcal/mol
Reverse Loops2.131 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.493 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceTCCTCGCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGC
CCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)991129 - 1227
NM_003987 (PAX2)991129 - 1227
Exon 5 To Exon 6 (Pair 6)
Forward (1136,22)TCCAATGGTGAGAAGAGGAAACAmplicon SizecDNA: 92 bpgenomic: 5,669
Reverse (1227,21)GTCCAGACCAGATGCAAACCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.487 kcal/mol
Forward Dimers-1.338 kcal/mol
Reverse Loops2.131 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.493 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATT
AGAGGAGGTGGAGGTTTGCATCTGGTCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)921136 - 1227
NM_003987 (PAX2)921136 - 1227
Exon 5 To Exon 7 (Pair 29)
Forward (1143,22)GTGAGAAGAGGAAACGTGATGAAmplicon SizecDNA: 188 bpgenomic: 25,183
Reverse (1330,20)CTGCTGCTGGGTGAAGGTGTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops2.48 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.244 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGCCCACATTAGAGGAG
GTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATG
GAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCC
AGCAGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1881143 - 1330
NM_003989 (PAX2)1191143 - 1261
NM_003987 (PAX2)1881143 - 1330
NM_003988 (PAX2)1191143 - 1261
NM_000278 (PAX2)1191143 - 1261
Exon 5 To Exon 7 (Pair 30)
Forward (1129,21)TCCTCGCTCCAATGGTGAGAAAmplicon SizecDNA: 199 bpgenomic: 25,194
Reverse (1327,20)CTGCTGGGTGAAGGTGTCAGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.293 kcal/mol in 3' area
Forward Dimers-1.338 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers0.056 kcal/mol in 3' area
Forward-Reverse Dimers-1.495 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceTCCTCGCTCCAATGGTGAGAAGAGGAAACGTGATGAAGTTGAGGTATACACTGATCCTGC
CCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGG
CTCAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGC
TGACACCTTCACCCAGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1991129 - 1327
NM_003988 (PAX2)1301129 - 1258
NM_000278 (PAX2)1301129 - 1258
NM_003989 (PAX2)1301129 - 1258
NM_003987 (PAX2)1991129 - 1327
Exon 6 To Exon 7 (Pair 1)
Forward (1167,22)TTGAGGTATACACTGATCCTGCAmplicon SizecDNA: 125 bpgenomic: 19,543
Reverse (1291,21)CAAACTGTCCACACCACTCTGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol in 3' area
Forward Dimers-1.098 kcal/mol
Reverse Loops2.112 kcal/mol
Reverse Dimers-0.96 kcal/mol
Forward-Reverse Dimers-1.904 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGA
CTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACA
GTTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1251167 - 1291
NM_003987 (PAX2)1251167 - 1291
Exon 6 To Exon 7 (Pair 2)
Forward (1194,21)TTAGAGGAGGTGGAGGTTTGCAmplicon SizecDNA: 91 bpgenomic: 19,509
Reverse (1284,21)TCCACACCACTCTGGGAATCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.374 kcal/mol in 3' area
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.843 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceTTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAG
TCCCCAATGGAGATTCCCAGAGTGGTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)911194 - 1284
NM_003987 (PAX2)911194 - 1284
Exon 6 To Exon 7 (Pair 3)
Forward (1190,21)CACATTAGAGGAGGTGGAGGTAmplicon SizecDNA: 140 bpgenomic: 19,558
Reverse (1329,20)TGCTGCTGGGTGAAGGTGTCNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.948 kcal/mol
Forward Dimers-0.311 kcal/mol
Reverse Loops1.997 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.292 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGC
TCAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCT
GACACCTTCACCCAGCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1401190 - 1329
NM_003987 (PAX2)1401190 - 1329
Exon 6 To Exon 7 (Pair 4)
Forward (1208,21)GGTTTGCATCTGGTCTGGACTAmplicon SizecDNA: 123 bpgenomic: 19,541
Reverse (1330,20)CTGCTGCTGGGTGAAGGTGTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.808 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops2.48 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGAT
TCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAGCAG
CAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1231208 - 1330
NM_003987 (PAX2)1231208 - 1330
Exon 6 To Exon 7 (Pair 5)
Forward (1191,22)ACATTAGAGGAGGTGGAGGTTTAmplicon SizecDNA: 140 bpgenomic: 19,558
Reverse (1330,20)CTGCTGCTGGGTGAAGGTGTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops2.48 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.292 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCT
CAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTG
ACACCTTCACCCAGCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1401191 - 1330
NM_003987 (PAX2)1401191 - 1330
Exon 6 To Exon 7 (Pair 6)
Forward (1191,22)ACATTAGAGGAGGTGGAGGTTTAmplicon SizecDNA: 101 bpgenomic: 19,519
Reverse (1291,21)CAAACTGTCCACACCACTCTGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops2.112 kcal/mol
Reverse Dimers-0.96 kcal/mol
Forward-Reverse Dimers-2.843 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCT
CAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1011191 - 1291
NM_003987 (PAX2)1011191 - 1291
Exon 6 To Exon 7 (Pair 7)
Forward (1207,21)AGGTTTGCATCTGGTCTGGACAmplicon SizecDNA: 124 bpgenomic: 19,542
Reverse (1330,20)CTGCTGCTGGGTGAAGGTGTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.882 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops2.48 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGA
TTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAGCA
GCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1241207 - 1330
NM_003987 (PAX2)1241207 - 1330
Exon 6 To Exon 7 (Pair 8)
Forward (1210,23)TTTGCATCTGGTCTGGACTTTAAAmplicon SizecDNA: 72 bpgenomic: 19,490
Reverse (1281,21)ACACCACTCTGGGAATCTCCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.241 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTC
CCAGAGTGGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)721210 - 1281
NM_003987 (PAX2)721210 - 1281
Exon 6 To Exon 7 (Pair 9)
Forward (1191,22)ACATTAGAGGAGGTGGAGGTTTAmplicon SizecDNA: 102 bpgenomic: 19,520
Reverse (1292,21)GCAAACTGTCCACACCACTCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops2.112 kcal/mol
Reverse Dimers-0.96 kcal/mol
Forward-Reverse Dimers-2.843 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCT
CAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1021191 - 1292
NM_003987 (PAX2)1021191 - 1292
Exon 6 To Exon 7 (Pair 10)
Forward (1207,21)AGGTTTGCATCTGGTCTGGACAmplicon SizecDNA: 74 bpgenomic: 19,492
Reverse (1280,21)CACCACTCTGGGAATCTCCATNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.882 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.241 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGA
TTCCCAGAGTGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)741207 - 1280
NM_003987 (PAX2)741207 - 1280
Exon 6 To Exon 7 (Pair 11)
Forward (1201,21)AGGTGGAGGTTTGCATCTGGTAmplicon SizecDNA: 90 bpgenomic: 19,508
Reverse (1290,21)AAACTGTCCACACCACTCTGGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.907 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.884 kcal/mol in 3' area
Reverse Dimers-0.96 kcal/mol
Forward-Reverse Dimers-2.843 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAA
TGGAGATTCCCAGAGTGGTGTGGACAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)901201 - 1290
NM_003987 (PAX2)901201 - 1290
Exon 6 To Exon 7 (Pair 12)
Forward (1201,21)AGGTGGAGGTTTGCATCTGGTAmplicon SizecDNA: 84 bpgenomic: 19,502
Reverse (1284,21)TCCACACCACTCTGGGAATCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.907 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.843 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAA
TGGAGATTCCCAGAGTGGTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)841201 - 1284
NM_003987 (PAX2)841201 - 1284
Exon 6 To Exon 7 (Pair 13)
Forward (1167,22)TTGAGGTATACACTGATCCTGCAmplicon SizecDNA: 126 bpgenomic: 19,544
Reverse (1292,21)GCAAACTGTCCACACCACTCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol in 3' area
Forward Dimers-1.098 kcal/mol
Reverse Loops2.112 kcal/mol
Reverse Dimers-0.96 kcal/mol
Forward-Reverse Dimers-1.904 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGA
CTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACA
GTTTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1261167 - 1292
NM_003987 (PAX2)1261167 - 1292
Exon 6 To Exon 7 (Pair 14)
Forward (1206,21)GAGGTTTGCATCTGGTCTGGAAmplicon SizecDNA: 76 bpgenomic: 19,494
Reverse (1281,21)ACACCACTCTGGGAATCTCCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.907 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.241 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAG
ATTCCCAGAGTGGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)761206 - 1281
NM_003987 (PAX2)761206 - 1281
Exon 6 To Exon 7 (Pair 15)
Forward (1191,22)ACATTAGAGGAGGTGGAGGTTTAmplicon SizecDNA: 104 bpgenomic: 19,522
Reverse (1294,20)CCGCAAACTGTCCACACCACNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops2.112 kcal/mol in 3' area
Reverse Dimers-0.96 kcal/mol
Forward-Reverse Dimers-2.843 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCT
CAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1041191 - 1294
NM_003987 (PAX2)1041191 - 1294
Exon 6 To Exon 7 (Pair 16)
Forward (1201,21)AGGTGGAGGTTTGCATCTGGTAmplicon SizecDNA: 91 bpgenomic: 19,509
Reverse (1291,21)CAAACTGTCCACACCACTCTGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.907 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops2.112 kcal/mol
Reverse Dimers-0.96 kcal/mol
Forward-Reverse Dimers-2.843 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAA
TGGAGATTCCCAGAGTGGTGTGGACAGTTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)911201 - 1291
NM_003987 (PAX2)911201 - 1291
Exon 6 To Exon 7 (Pair 17)
Forward (1194,21)TTAGAGGAGGTGGAGGTTTGCAmplicon SizecDNA: 98 bpgenomic: 19,516
Reverse (1291,21)CAAACTGTCCACACCACTCTGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.374 kcal/mol in 3' area
Reverse Loops2.112 kcal/mol
Reverse Dimers-0.96 kcal/mol
Forward-Reverse Dimers-2.843 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceTTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAG
TCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)981194 - 1291
NM_003987 (PAX2)981194 - 1291
Exon 6 To Exon 7 (Pair 18)
Forward (1209,22)GTTTGCATCTGGTCTGGACTTTAmplicon SizecDNA: 73 bpgenomic: 19,491
Reverse (1281,21)ACACCACTCTGGGAATCTCCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.241 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATT
CCCAGAGTGGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)731209 - 1281
NM_003987 (PAX2)731209 - 1281
Exon 6 To Exon 7 (Pair 19)
Forward (1203,21)GTGGAGGTTTGCATCTGGTCTAmplicon SizecDNA: 88 bpgenomic: 19,506
Reverse (1290,21)AAACTGTCCACACCACTCTGGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.907 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.884 kcal/mol in 3' area
Reverse Dimers-0.96 kcal/mol
Forward-Reverse Dimers-2.552 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATG
GAGATTCCCAGAGTGGTGTGGACAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)881203 - 1290
NM_003987 (PAX2)881203 - 1290
Exon 6 To Exon 7 (Pair 20)
Forward (1204,21)TGGAGGTTTGCATCTGGTCTGAmplicon SizecDNA: 127 bpgenomic: 19,545
Reverse (1330,20)CTGCTGCTGGGTGAAGGTGTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.907 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops2.48 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGG
AGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCA
GCAGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1271204 - 1330
NM_003987 (PAX2)1271204 - 1330
Exon 6 To Exon 7 (Pair 21)
Forward (1191,22)ACATTAGAGGAGGTGGAGGTTTAmplicon SizecDNA: 138 bpgenomic: 19,556
Reverse (1328,20)GCTGCTGGGTGAAGGTGTCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.292 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCT
CAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTG
ACACCTTCACCCAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1381191 - 1328
NM_003987 (PAX2)1381191 - 1328
Exon 6 To Exon 7 (Pair 22)
Forward (1167,22)TTGAGGTATACACTGATCCTGCAmplicon SizecDNA: 118 bpgenomic: 19,536
Reverse (1284,21)TCCACACCACTCTGGGAATCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol in 3' area
Forward Dimers-1.098 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-1.904 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGA
CTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1181167 - 1284
NM_003987 (PAX2)1181167 - 1284
Exon 6 To Exon 7 (Pair 23)
Forward (1209,22)GTTTGCATCTGGTCTGGACTTTAmplicon SizecDNA: 76 bpgenomic: 19,494
Reverse (1284,21)TCCACACCACTCTGGGAATCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.299 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATT
CCCAGAGTGGTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)761209 - 1284
NM_003987 (PAX2)761209 - 1284
Exon 6 To Exon 7 (Pair 24)
Forward (1190,21)CACATTAGAGGAGGTGGAGGTAmplicon SizecDNA: 141 bpgenomic: 19,559
Reverse (1330,20)CTGCTGCTGGGTGAAGGTGTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.948 kcal/mol
Forward Dimers-0.311 kcal/mol
Reverse Loops2.48 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.292 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGC
TCAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCT
GACACCTTCACCCAGCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1411190 - 1330
NM_003987 (PAX2)1411190 - 1330
Exon 6 To Exon 7 (Pair 25)
Forward (1194,21)TTAGAGGAGGTGGAGGTTTGCAmplicon SizecDNA: 135 bpgenomic: 19,553
Reverse (1328,20)GCTGCTGGGTGAAGGTGTCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.374 kcal/mol in 3' area
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.292 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceTTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAG
TCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACA
CCTTCACCCAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1351194 - 1328
NM_003987 (PAX2)1351194 - 1328
Exon 6 To Exon 7 (Pair 26)
Forward (1203,21)GTGGAGGTTTGCATCTGGTCTAmplicon SizecDNA: 89 bpgenomic: 19,507
Reverse (1291,21)CAAACTGTCCACACCACTCTGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.907 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops2.112 kcal/mol
Reverse Dimers-0.96 kcal/mol
Forward-Reverse Dimers-2.552 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATG
GAGATTCCCAGAGTGGTGTGGACAGTTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)891203 - 1291
NM_003987 (PAX2)891203 - 1291
Exon 6 To Exon 7 (Pair 27)
Forward (1194,21)TTAGAGGAGGTGGAGGTTTGCAmplicon SizecDNA: 136 bpgenomic: 19,554
Reverse (1329,20)TGCTGCTGGGTGAAGGTGTCNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.374 kcal/mol in 3' area
Reverse Loops1.997 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.292 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceTTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAG
TCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACA
CCTTCACCCAGCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1361194 - 1329
NM_003987 (PAX2)1361194 - 1329
Exon 6 To Exon 7 (Pair 28)
Forward (1208,21)GGTTTGCATCTGGTCTGGACTAmplicon SizecDNA: 73 bpgenomic: 19,491
Reverse (1280,21)CACCACTCTGGGAATCTCCATNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.808 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.241 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGAT
TCCCAGAGTGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)731208 - 1280
NM_003987 (PAX2)731208 - 1280
Exon 6 To Exon 7 (Pair 29)
Forward (1206,21)GAGGTTTGCATCTGGTCTGGAAmplicon SizecDNA: 125 bpgenomic: 19,543
Reverse (1330,20)CTGCTGCTGGGTGAAGGTGTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.907 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops2.48 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAG
ATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAGC
AGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1251206 - 1330
NM_003987 (PAX2)1251206 - 1330
Exon 6 To Exon 7 (Pair 30)
Forward (1213,22)GCATCTGGTCTGGACTTTAAGAAmplicon SizecDNA: 115 bpgenomic: 19,533
Reverse (1327,20)CTGCTGGGTGAAGGTGTCAGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-1.101 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers0.056 kcal/mol in 3' area
Forward-Reverse Dimers-0.989 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCA
GAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1151213 - 1327
NM_003987 (PAX2)1151213 - 1327
Exon 6 To Exon 7 (Pair 31)
Forward (1167,22)TTGAGGTATACACTGATCCTGCAmplicon SizecDNA: 124 bpgenomic: 19,542
Reverse (1290,21)AAACTGTCCACACCACTCTGGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol in 3' area
Forward Dimers-1.098 kcal/mol
Reverse Loops0.884 kcal/mol in 3' area
Reverse Dimers-0.96 kcal/mol
Forward-Reverse Dimers-1.904 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGA
CTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACA
GTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1241167 - 1290
NM_003987 (PAX2)1241167 - 1290
Exon 6 To Exon 7 (Pair 32)
Forward (1213,22)GCATCTGGTCTGGACTTTAAGAAmplicon SizecDNA: 117 bpgenomic: 19,535
Reverse (1329,20)TGCTGCTGGGTGAAGGTGTCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-1.101 kcal/mol
Reverse Loops1.997 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-0.989 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCA
GAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAGCAGCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1171213 - 1329
NM_003987 (PAX2)1171213 - 1329
Exon 6 To Exon 7 (Pair 33)
Forward (1213,22)GCATCTGGTCTGGACTTTAAGAAmplicon SizecDNA: 116 bpgenomic: 19,534
Reverse (1328,20)GCTGCTGGGTGAAGGTGTCANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-1.101 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-0.989 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCA
GAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAGCAGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1161213 - 1328
NM_003987 (PAX2)1161213 - 1328
Exon 6 To Exon 7 (Pair 34)
Forward (1191,22)ACATTAGAGGAGGTGGAGGTTTAmplicon SizecDNA: 137 bpgenomic: 19,555
Reverse (1327,20)CTGCTGGGTGAAGGTGTCAGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers0.056 kcal/mol in 3' area
Forward-Reverse Dimers-0.918 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCT
CAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTG
ACACCTTCACCCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1371191 - 1327
NM_003987 (PAX2)1371191 - 1327
Exon 6 To Exon 7 (Pair 35)
Forward (1208,21)GGTTTGCATCTGGTCTGGACTAmplicon SizecDNA: 74 bpgenomic: 19,492
Reverse (1281,21)ACACCACTCTGGGAATCTCCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.808 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.241 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGAT
TCCCAGAGTGGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)741208 - 1281
NM_003987 (PAX2)741208 - 1281
Exon 6 To Exon 7 (Pair 36)
Forward (1167,22)TTGAGGTATACACTGATCCTGCAmplicon SizecDNA: 115 bpgenomic: 19,533
Reverse (1281,21)ACACCACTCTGGGAATCTCCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol in 3' area
Forward Dimers-1.098 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-1.904 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGA
CTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCAGAGTGGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1151167 - 1281
NM_003987 (PAX2)1151167 - 1281
Exon 6 To Exon 7 (Pair 37)
Forward (1167,22)TTGAGGTATACACTGATCCTGCAmplicon SizecDNA: 114 bpgenomic: 19,532
Reverse (1280,21)CACCACTCTGGGAATCTCCATNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol in 3' area
Forward Dimers-1.098 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-1.904 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGA
CTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCAGAGTGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1141167 - 1280
NM_003987 (PAX2)1141167 - 1280
Exon 6 To Exon 7 (Pair 38)
Forward (1207,21)AGGTTTGCATCTGGTCTGGACAmplicon SizecDNA: 75 bpgenomic: 19,493
Reverse (1281,21)ACACCACTCTGGGAATCTCCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.882 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.241 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGA
TTCCCAGAGTGGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)751207 - 1281
NM_003987 (PAX2)751207 - 1281
Exon 6 To Exon 7 (Pair 39)
Forward (1206,21)GAGGTTTGCATCTGGTCTGGAAmplicon SizecDNA: 75 bpgenomic: 19,493
Reverse (1280,21)CACCACTCTGGGAATCTCCATNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.907 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.241 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAG
ATTCCCAGAGTGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)751206 - 1280
NM_003987 (PAX2)751206 - 1280
Exon 6 To Exon 7 (Pair 40)
Forward (1213,22)GCATCTGGTCTGGACTTTAAGAAmplicon SizecDNA: 72 bpgenomic: 19,490
Reverse (1284,21)TCCACACCACTCTGGGAATCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-1.101 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.299 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCA
GAGTGGTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)721213 - 1284
NM_003987 (PAX2)721213 - 1284
Exon 6 To Exon 7 (Pair 41)
Forward (1191,22)ACATTAGAGGAGGTGGAGGTTTAmplicon SizecDNA: 94 bpgenomic: 19,512
Reverse (1284,21)TCCACACCACTCTGGGAATCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.843 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCT
CAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)941191 - 1284
NM_003987 (PAX2)941191 - 1284
Exon 6 To Exon 7 (Pair 42)
Forward (1203,21)GTGGAGGTTTGCATCTGGTCTAmplicon SizecDNA: 82 bpgenomic: 19,500
Reverse (1284,21)TCCACACCACTCTGGGAATCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.907 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.552 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATG
GAGATTCCCAGAGTGGTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)821203 - 1284
NM_003987 (PAX2)821203 - 1284
Exon 6 To Exon 7 (Pair 43)
Forward (1214,22)CATCTGGTCTGGACTTTAAGAGAmplicon SizecDNA: 114 bpgenomic: 19,532
Reverse (1327,20)CTGCTGGGTGAAGGTGTCAGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-1.101 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers0.056 kcal/mol in 3' area
Forward-Reverse Dimers-0.989 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCAG
AGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1141214 - 1327
NM_003987 (PAX2)1141214 - 1327
Exon 6 To Exon 7 (Pair 44)
Forward (1203,21)GTGGAGGTTTGCATCTGGTCTAmplicon SizecDNA: 128 bpgenomic: 19,546
Reverse (1330,20)CTGCTGCTGGGTGAAGGTGTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.907 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops2.48 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATG
GAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCC
AGCAGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1281203 - 1330
NM_003987 (PAX2)1281203 - 1330
Exon 6 To Exon 7 (Pair 45)
Forward (1194,21)TTAGAGGAGGTGGAGGTTTGCAmplicon SizecDNA: 134 bpgenomic: 19,552
Reverse (1327,20)CTGCTGGGTGAAGGTGTCAGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.374 kcal/mol in 3' area
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers0.056 kcal/mol in 3' area
Forward-Reverse Dimers-0.918 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceTTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAG
TCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACA
CCTTCACCCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1341194 - 1327
NM_003987 (PAX2)1341194 - 1327
Exon 6 To Exon 7 (Pair 46)
Forward (1212,22)TGCATCTGGTCTGGACTTTAAGAmplicon SizecDNA: 73 bpgenomic: 19,491
Reverse (1284,21)TCCACACCACTCTGGGAATCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers-1.101 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.299 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCC
AGAGTGGTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)731212 - 1284
NM_003987 (PAX2)731212 - 1284
Exon 6 To Exon 7 (Pair 47)
Forward (1210,23)TTTGCATCTGGTCTGGACTTTAAAmplicon SizecDNA: 75 bpgenomic: 19,493
Reverse (1284,21)TCCACACCACTCTGGGAATCTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.299 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTC
CCAGAGTGGTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)751210 - 1284
NM_003987 (PAX2)751210 - 1284
Exon 6 To Exon 7 (Pair 48)
Forward (1194,21)TTAGAGGAGGTGGAGGTTTGCAmplicon SizecDNA: 137 bpgenomic: 19,555
Reverse (1330,20)CTGCTGCTGGGTGAAGGTGTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.374 kcal/mol in 3' area
Reverse Loops2.48 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.292 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceTTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAG
TCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACA
CCTTCACCCAGCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1371194 - 1330
NM_003987 (PAX2)1371194 - 1330
Exon 6 To Exon 7 (Pair 49)
Forward (1191,22)ACATTAGAGGAGGTGGAGGTTTAmplicon SizecDNA: 139 bpgenomic: 19,557
Reverse (1329,20)TGCTGCTGGGTGAAGGTGTCNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops1.997 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.292 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCT
CAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTG
ACACCTTCACCCAGCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1391191 - 1329
NM_003987 (PAX2)1391191 - 1329
Exon 6 To Exon 7 (Pair 50)
Forward (1194,21)TTAGAGGAGGTGGAGGTTTGCAmplicon SizecDNA: 97 bpgenomic: 19,515
Reverse (1290,21)AAACTGTCCACACCACTCTGGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.374 kcal/mol in 3' area
Reverse Loops0.884 kcal/mol in 3' area
Reverse Dimers-0.96 kcal/mol
Forward-Reverse Dimers-2.843 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceTTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAG
TCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)971194 - 1290
NM_003987 (PAX2)971194 - 1290
Exon 6 To Exon 7 (Pair 51)
Forward (1190,21)CACATTAGAGGAGGTGGAGGTAmplicon SizecDNA: 138 bpgenomic: 19,556
Reverse (1327,20)CTGCTGGGTGAAGGTGTCAGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.948 kcal/mol
Forward Dimers-0.311 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers0.056 kcal/mol in 3' area
Forward-Reverse Dimers-1.198 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGC
TCAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCT
GACACCTTCACCCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1381190 - 1327
NM_003987 (PAX2)1381190 - 1327
Exon 6 To Exon 7 (Pair 52)
Forward (1214,22)CATCTGGTCTGGACTTTAAGAGAmplicon SizecDNA: 115 bpgenomic: 19,533
Reverse (1328,20)GCTGCTGGGTGAAGGTGTCANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-1.101 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-0.989 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCAG
AGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAGCAGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1151214 - 1328
NM_003987 (PAX2)1151214 - 1328
Exon 6 To Exon 7 (Pair 53)
Forward (1209,22)GTTTGCATCTGGTCTGGACTTTAmplicon SizecDNA: 72 bpgenomic: 19,490
Reverse (1280,21)CACCACTCTGGGAATCTCCATNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops0.723 kcal/mol
Reverse Dimers-0.857 kcal/mol
Forward-Reverse Dimers-2.241 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATT
CCCAGAGTGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)721209 - 1280
NM_003987 (PAX2)721209 - 1280
Exon 6 To Exon 7 (Pair 54)
Forward (1190,21)CACATTAGAGGAGGTGGAGGTAmplicon SizecDNA: 139 bpgenomic: 19,557
Reverse (1328,20)GCTGCTGGGTGAAGGTGTCANr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.948 kcal/mol
Forward Dimers-0.311 kcal/mol
Reverse Loops1.44 kcal/mol in 3' area
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.292 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGC
TCAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCT
GACACCTTCACCCAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1391190 - 1328
NM_003987 (PAX2)1391190 - 1328
Exon 6 To Exon 7 (Pair 55)
Forward (1214,22)CATCTGGTCTGGACTTTAAGAGAmplicon SizecDNA: 116 bpgenomic: 19,534
Reverse (1329,20)TGCTGCTGGGTGAAGGTGTCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-1.101 kcal/mol
Reverse Loops1.997 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-0.989 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCAG
AGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAGCAGCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003990 (PAX2)1161214 - 1329
NM_003987 (PAX2)1161214 - 1329
Exon 6 To Exon 7 (Pair 56)
Forward (1201,21)AGGTGGAGGTTTGCATCTGGTAmplicon SizecDNA: 130 bpgenomic: 19,548
Reverse (1330,20)CTGCTGCTGGGTGAAGGTGTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.907 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops2.48 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.762 kcal/mol outside primersite
Amplicon SequenceAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAA
TGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCAC
CCAGCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1301201 - 1330
NM_003987 (PAX2)1301201 - 1330
Exon 6 To Exon 7 (Pair 57)
Forward (1167,22)TTGAGGTATACACTGATCCTGCAmplicon SizecDNA: 164 bpgenomic: 19,582
Reverse (1330,20)CTGCTGCTGGGTGAAGGTGTNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol in 3' area
Forward Dimers-1.098 kcal/mol
Reverse Loops2.48 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.487 kcal/mol
Amplicon Folding-1.014 kcal/mol outside primersite
Amplicon SequenceTTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGA
CTTTAAGAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACA
GTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAGCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1641167 - 1330
NM_003987 (PAX2)1641167 - 1330
Exon 6 To Exon 7 (Pair 58)
Forward (1191,22)ACATTAGAGGAGGTGGAGGTTTAmplicon SizecDNA: 100 bpgenomic: 19,518
Reverse (1290,21)AAACTGTCCACACCACTCTGGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops0.884 kcal/mol in 3' area
Reverse Dimers-0.96 kcal/mol
Forward-Reverse Dimers-2.843 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGCT
CAGTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1001191 - 1290
NM_003987 (PAX2)1001191 - 1290
Exon 6 To Exon 7 (Pair 59)
Forward (1190,21)CACATTAGAGGAGGTGGAGGTAmplicon SizecDNA: 88 bpgenomic: 19,506
Reverse (1277,21)CACTCTGGGAATCTCCATTGGNr. of Isoforms 2 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.948 kcal/mol
Forward Dimers-0.311 kcal/mol
Reverse Loops0.853 kcal/mol
Reverse Dimers-0.619 kcal/mol
Forward-Reverse Dimers-2.356 kcal/mol
Amplicon Folding0.415 kcal/mol outside primersite
Amplicon SequenceCACATTAGAGGAGGTGGAGGTTTGCATCTGGTCTGGACTTTAAGAGATGTGTCTGAGGGC
TCAGTCCCCAATGGAGATTCCCAGAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)881190 - 1277
NM_003987 (PAX2)881190 - 1277
Exon 8 To Exon 9 (Pair 1)
Forward (1473,20)CTGCATCCACCAACCCTGAGAmplicon SizecDNA: 102 bpgenomic: 15,513
Reverse (1574,20)GGTAACCAGGCAGAGTGGTGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.598 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops0.134 kcal/mol in 3' area
Reverse Dimers-1.865 kcal/mol
Forward-Reverse Dimers-2.707 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceCTGCATCCACCAACCCTGAGCTGGGCAGCAACGTGTCAGGCACACAGACATACCCAGTTG
TGACTGGTCGTGACATGGCGAGCACCACTCTGCCTGGTTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003990 (PAX2)1021473 - 1574
NM_003989 (PAX2)1021404 - 1505
NM_003987 (PAX2)1021473 - 1574
NM_003988 (PAX2)1021404 - 1505
NM_000278 (PAX2)1021404 - 1505
 

See below for some more details.

Program Output:

Loading ...