Design Results for pax8

(Canis Lupus Familiaris, Broad CanFam3.1/canFam3)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 2 (Pair 1)
Forward (1,21)ATGCCGCACAACTCCATCAGAAmplicon SizecDNA: 104 bpgenomic: 31,029
Reverse (104,21)ACGATGCGTTGACGTACCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.259 kcal/mol in 3' area
Forward Dimers-1.55 kcal/mol
Reverse Loops0.763 kcal/mol
Reverse Dimers-2.942 kcal/mol
Forward-Reverse Dimers-2.606 kcal/mol
Amplicon Folding-2.378 kcal/mol outside primersite
Amplicon SequenceATGCCGCACAACTCCATCAGATCCGGCCATGGAGGGCTGAACCAGCTGGGAGGGGCCTTT
GTGAACGGCAGACCTCTGCCTGAAGTGGTACGTCAACGCATCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003248 (PAX8)1041 - 104
Exon 1 To Exon 2 (Pair 2)
Forward (2,21)TGCCGCACAACTCCATCAGATAmplicon SizecDNA: 108 bpgenomic: 31,033
Reverse (109,20)GGTCCACGATGCGTTGACGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.259 kcal/mol in 3' area
Forward Dimers-0.948 kcal/mol
Reverse Loops0.289 kcal/mol
Reverse Dimers-2.106 kcal/mol
Forward-Reverse Dimers-2.606 kcal/mol
Amplicon Folding-2.378 kcal/mol outside primersite
Amplicon SequenceTGCCGCACAACTCCATCAGATCCGGCCATGGAGGGCTGAACCAGCTGGGAGGGGCCTTTG
TGAACGGCAGACCTCTGCCTGAAGTGGTACGTCAACGCATCGTGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003248 (PAX8)1082 - 109
Exon 1 To Exon 2 (Pair 3)
Forward (2,21)TGCCGCACAACTCCATCAGATAmplicon SizecDNA: 102 bpgenomic: 31,027
Reverse (103,21)CGATGCGTTGACGTACCACTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.259 kcal/mol in 3' area
Forward Dimers-0.948 kcal/mol
Reverse Loops0.998 kcal/mol
Reverse Dimers-2.942 kcal/mol
Forward-Reverse Dimers-2.606 kcal/mol
Amplicon Folding-2.378 kcal/mol outside primersite
Amplicon SequenceTGCCGCACAACTCCATCAGATCCGGCCATGGAGGGCTGAACCAGCTGGGAGGGGCCTTTG
TGAACGGCAGACCTCTGCCTGAAGTGGTACGTCAACGCATCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003248 (PAX8)1022 - 103
Exon 1 To Exon 2 (Pair 4)
Forward (2,21)TGCCGCACAACTCCATCAGATAmplicon SizecDNA: 103 bpgenomic: 31,028
Reverse (104,21)ACGATGCGTTGACGTACCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.259 kcal/mol in 3' area
Forward Dimers-0.948 kcal/mol
Reverse Loops0.763 kcal/mol
Reverse Dimers-2.942 kcal/mol
Forward-Reverse Dimers-2.606 kcal/mol
Amplicon Folding-2.378 kcal/mol outside primersite
Amplicon SequenceTGCCGCACAACTCCATCAGATCCGGCCATGGAGGGCTGAACCAGCTGGGAGGGGCCTTTG
TGAACGGCAGACCTCTGCCTGAAGTGGTACGTCAACGCATCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003248 (PAX8)1032 - 104
Exon 1 To Exon 2 (Pair 5)
Forward (2,21)TGCCGCACAACTCCATCAGATAmplicon SizecDNA: 109 bpgenomic: 31,034
Reverse (110,20)AGGTCCACGATGCGTTGACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.259 kcal/mol in 3' area
Forward Dimers-0.948 kcal/mol
Reverse Loops0.289 kcal/mol
Reverse Dimers-2.106 kcal/mol
Forward-Reverse Dimers-2.606 kcal/mol
Amplicon Folding-2.378 kcal/mol outside primersite
Amplicon SequenceTGCCGCACAACTCCATCAGATCCGGCCATGGAGGGCTGAACCAGCTGGGAGGGGCCTTTG
TGAACGGCAGACCTCTGCCTGAAGTGGTACGTCAACGCATCGTGGACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003248 (PAX8)1092 - 110
Exon 1 To Exon 2 (Pair 6)
Forward (1,21)ATGCCGCACAACTCCATCAGAAmplicon SizecDNA: 109 bpgenomic: 31,034
Reverse (109,20)GGTCCACGATGCGTTGACGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.259 kcal/mol in 3' area
Forward Dimers-1.55 kcal/mol
Reverse Loops0.289 kcal/mol
Reverse Dimers-2.106 kcal/mol
Forward-Reverse Dimers-2.606 kcal/mol
Amplicon Folding-2.378 kcal/mol outside primersite
Amplicon SequenceATGCCGCACAACTCCATCAGATCCGGCCATGGAGGGCTGAACCAGCTGGGAGGGGCCTTT
GTGAACGGCAGACCTCTGCCTGAAGTGGTACGTCAACGCATCGTGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003248 (PAX8)1091 - 109
Exon 1 To Exon 2 (Pair 7)
Forward (1,21)ATGCCGCACAACTCCATCAGAAmplicon SizecDNA: 110 bpgenomic: 31,035
Reverse (110,20)AGGTCCACGATGCGTTGACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.259 kcal/mol in 3' area
Forward Dimers-1.55 kcal/mol
Reverse Loops0.289 kcal/mol
Reverse Dimers-2.106 kcal/mol
Forward-Reverse Dimers-2.606 kcal/mol
Amplicon Folding-2.378 kcal/mol outside primersite
Amplicon SequenceATGCCGCACAACTCCATCAGATCCGGCCATGGAGGGCTGAACCAGCTGGGAGGGGCCTTT
GTGAACGGCAGACCTCTGCCTGAAGTGGTACGTCAACGCATCGTGGACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003248 (PAX8)1101 - 110
Exon 1 To Exon 2 (Pair 8)
Forward (1,21)ATGCCGCACAACTCCATCAGAAmplicon SizecDNA: 103 bpgenomic: 31,028
Reverse (103,21)CGATGCGTTGACGTACCACTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.259 kcal/mol in 3' area
Forward Dimers-1.55 kcal/mol
Reverse Loops0.998 kcal/mol
Reverse Dimers-2.942 kcal/mol
Forward-Reverse Dimers-2.606 kcal/mol
Amplicon Folding-2.378 kcal/mol outside primersite
Amplicon SequenceATGCCGCACAACTCCATCAGATCCGGCCATGGAGGGCTGAACCAGCTGGGAGGGGCCTTT
GTGAACGGCAGACCTCTGCCTGAAGTGGTACGTCAACGCATCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003248 (PAX8)1031 - 103
Exon 1 To Exon 2 (Pair 9)
Forward (2,21)TGCCGCACAACTCCATCAGATAmplicon SizecDNA: 101 bpgenomic: 31,026
Reverse (102,21)GATGCGTTGACGTACCACTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.259 kcal/mol in 3' area
Forward Dimers-0.948 kcal/mol
Reverse Loops0.998 kcal/mol
Reverse Dimers-2.942 kcal/mol
Forward-Reverse Dimers-2.606 kcal/mol
Amplicon Folding-2.378 kcal/mol outside primersite
Amplicon SequenceTGCCGCACAACTCCATCAGATCCGGCCATGGAGGGCTGAACCAGCTGGGAGGGGCCTTTG
TGAACGGCAGACCTCTGCCTGAAGTGGTACGTCAACGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003248 (PAX8)1012 - 102
Exon 1 To Exon 2 (Pair 10)
Forward (1,21)ATGCCGCACAACTCCATCAGAAmplicon SizecDNA: 102 bpgenomic: 31,027
Reverse (102,21)GATGCGTTGACGTACCACTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.259 kcal/mol in 3' area
Forward Dimers-1.55 kcal/mol
Reverse Loops0.998 kcal/mol
Reverse Dimers-2.942 kcal/mol
Forward-Reverse Dimers-2.606 kcal/mol
Amplicon Folding-2.378 kcal/mol outside primersite
Amplicon SequenceATGCCGCACAACTCCATCAGATCCGGCCATGGAGGGCTGAACCAGCTGGGAGGGGCCTTT
GTGAACGGCAGACCTCTGCCTGAAGTGGTACGTCAACGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003248 (PAX8)1021 - 102
 

See below for some more details.

Program Output:

Loading ...