Design Results for pnpla3

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 7 To Exon 8 (Pair 1)
Forward (1205,23)CTTGCTACCCATTAGGATAATGTAmplicon SizecDNA: 136 bpgenomic: 4,701
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceCTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATC
TGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCT
GTGGTTGCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1361205 - 1340
Exon 7 To Exon 8 (Pair 2)
Forward (1201,22)GCAACTTGCTACCCATTAGGATAmplicon SizecDNA: 142 bpgenomic: 4,707
Reverse (1342,20)GTCACCCACTGCAACCACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol in 3' area
Forward Dimers-0.731 kcal/mol
Reverse Loops1.249 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGG
AATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATG
TCCTGTGGTTGCAGTGGGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1421201 - 1342
Exon 7 To Exon 8 (Pair 3)
Forward (1204,23)ACTTGCTACCCATTAGGATAATGAmplicon SizecDNA: 138 bpgenomic: 4,703
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAAT
CTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCC
TGTGGTTGCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1381204 - 1341
Exon 7 To Exon 8 (Pair 4)
Forward (1200,22)TGCAACTTGCTACCCATTAGGAAmplicon SizecDNA: 142 bpgenomic: 4,707
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol in 3' area
Forward Dimers-1.273 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.671 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTG
GAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGAT
GTCCTGTGGTTGCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1421200 - 1341
Exon 7 To Exon 9 (Pair 1)
Forward (1196,23)GATTTGCAACTTGCTACCCATTAAmplicon SizecDNA: 218 bpgenomic: 6,141
Reverse (1413,20)GGCTGCTCACTGGCATTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops0.823 kcal/mol
Reverse Dimers-1.036 kcal/mol
Forward-Reverse Dimers-1.322 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCC
TGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGA
CGATGTCCTGTGGTTGCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGTCT
GCTCCCCGCCTCCAGGTCCCAAATGCCAGTGAGCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2181196 - 1413
Exon 7 To Exon 8 (Pair 5)
Forward (1194,23)AAGATTTGCAACTTGCTACCCATAmplicon SizecDNA: 149 bpgenomic: 4,714
Reverse (1342,20)GTCACCCACTGCAACCACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.249 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceAAGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTG
CCTGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCC
GACGATGTCCTGTGGTTGCAGTGGGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1491194 - 1342
Exon 7 To Exon 8 (Pair 6)
Forward (1195,23)AGATTTGCAACTTGCTACCCATTAmplicon SizecDNA: 147 bpgenomic: 4,712
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceAGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGC
CTGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCG
ACGATGTCCTGTGGTTGCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1471195 - 1341
Exon 7 To Exon 8 (Pair 7)
Forward (1199,22)TTGCAACTTGCTACCCATTAGGAmplicon SizecDNA: 141 bpgenomic: 4,706
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.014 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.072 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGT
GGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGA
TGTCCTGTGGTTGCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1411199 - 1339
Exon 7 To Exon 8 (Pair 8)
Forward (1208,23)GCTACCCATTAGGATAATGTCTTAmplicon SizecDNA: 132 bpgenomic: 4,697
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGC
CATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTG
GTTGCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1321208 - 1339
Exon 7 To Exon 9 (Pair 2)
Forward (1228,22)CTTATGTAATGCTGCCCTGTACAmplicon SizecDNA: 189 bpgenomic: 6,112
Reverse (1416,21)GTTGGCTGCTCACTGGCATTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.548 kcal/mol
Forward Dimers-0.93 kcal/mol
Reverse Loops0.823 kcal/mol in 3' area
Reverse Dimers-1.07 kcal/mol
Forward-Reverse Dimers-2.762 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCATTGCGATTGTCCAGAGAC
TGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTTGCAGTGGGTGACCTCAC
AGGTGTTCACTCGAGTGCTGATGTGTCTGCTCCCCGCCTCCAGGTCCCAAATGCCAGTGA
GCAGCCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1891228 - 1416
Exon 7 To Exon 9 (Pair 3)
Forward (1201,22)GCAACTTGCTACCCATTAGGATAmplicon SizecDNA: 218 bpgenomic: 6,141
Reverse (1418,20)CTGTTGGCTGCTCACTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol in 3' area
Forward Dimers-0.731 kcal/mol
Reverse Loops0.823 kcal/mol in 3' area
Reverse Dimers-1.07 kcal/mol
Forward-Reverse Dimers-1.077 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGG
AATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATG
TCCTGTGGTTGCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGTCTGCTCC
CCGCCTCCAGGTCCCAAATGCCAGTGAGCAGCCAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2181201 - 1418
Exon 7 To Exon 8 (Pair 9)
Forward (1193,22)CAAGATTTGCAACTTGCTACCCAmplicon SizecDNA: 149 bpgenomic: 4,714
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceCAAGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCT
GCCTGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCC
CGACGATGTCCTGTGGTTGCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1491193 - 1341
Exon 7 To Exon 8 (Pair 10)
Forward (1211,24)ACCCATTAGGATAATGTCTTATGTAmplicon SizecDNA: 129 bpgenomic: 4,694
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCAT
TGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTT
GCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1291211 - 1339
Exon 7 To Exon 8 (Pair 11)
Forward (1196,23)GATTTGCAACTTGCTACCCATTAAmplicon SizecDNA: 147 bpgenomic: 4,712
Reverse (1342,20)GTCACCCACTGCAACCACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.249 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCC
TGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGA
CGATGTCCTGTGGTTGCAGTGGGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1471196 - 1342
Exon 7 To Exon 8 (Pair 12)
Forward (1195,23)AGATTTGCAACTTGCTACCCATTAmplicon SizecDNA: 145 bpgenomic: 4,710
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceAGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGC
CTGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCG
ACGATGTCCTGTGGTTGCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1451195 - 1339
Exon 7 To Exon 8 (Pair 13)
Forward (1197,23)ATTTGCAACTTGCTACCCATTAGAmplicon SizecDNA: 143 bpgenomic: 4,708
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCT
GTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGAC
GATGTCCTGTGGTTGCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1431197 - 1339
Exon 7 To Exon 8 (Pair 14)
Forward (1194,23)AAGATTTGCAACTTGCTACCCATAmplicon SizecDNA: 146 bpgenomic: 4,711
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceAAGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTG
CCTGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCC
GACGATGTCCTGTGGTTGCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1461194 - 1339
Exon 7 To Exon 8 (Pair 15)
Forward (1205,23)CTTGCTACCCATTAGGATAATGTAmplicon SizecDNA: 137 bpgenomic: 4,702
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceCTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATC
TGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCT
GTGGTTGCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1371205 - 1341
Exon 7 To Exon 8 (Pair 16)
Forward (1207,23)TGCTACCCATTAGGATAATGTCTAmplicon SizecDNA: 135 bpgenomic: 4,700
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTG
CCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGT
GGTTGCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1351207 - 1341
Exon 7 To Exon 9 (Pair 4)
Forward (1197,23)ATTTGCAACTTGCTACCCATTAGAmplicon SizecDNA: 217 bpgenomic: 6,140
Reverse (1413,20)GGCTGCTCACTGGCATTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops0.823 kcal/mol
Reverse Dimers-1.036 kcal/mol
Forward-Reverse Dimers-1.322 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCT
GTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGAC
GATGTCCTGTGGTTGCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGTCTG
CTCCCCGCCTCCAGGTCCCAAATGCCAGTGAGCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2171197 - 1413
Exon 7 To Exon 8 (Pair 17)
Forward (1205,23)CTTGCTACCCATTAGGATAATGTAmplicon SizecDNA: 135 bpgenomic: 4,700
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceCTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATC
TGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCT
GTGGTTGCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1351205 - 1339
Exon 7 To Exon 8 (Pair 18)
Forward (1209,24)CTACCCATTAGGATAATGTCTTATAmplicon SizecDNA: 132 bpgenomic: 4,697
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCC
ATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGG
TTGCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1321209 - 1340
Exon 7 To Exon 9 (Pair 5)
Forward (1210,24)TACCCATTAGGATAATGTCTTATGAmplicon SizecDNA: 209 bpgenomic: 6,132
Reverse (1418,20)CTGTTGGCTGCTCACTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops0.823 kcal/mol in 3' area
Reverse Dimers-1.07 kcal/mol
Forward-Reverse Dimers-0.735 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCA
TTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGT
TGCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGTCTGCTCCCCGCCTCCA
GGTCCCAAATGCCAGTGAGCAGCCAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2091210 - 1418
Exon 7 To Exon 8 (Pair 19)
Forward (1212,24)CCCATTAGGATAATGTCTTATGTAAmplicon SizecDNA: 129 bpgenomic: 4,694
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.531 kcal/mol
Forward Dimers-0.561 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceCCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCATT
GCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTTG
CAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1291212 - 1340
Exon 7 To Exon 8 (Pair 20)
Forward (1226,22)GTCTTATGTAATGCTGCCCTGTAmplicon SizecDNA: 117 bpgenomic: 4,682
Reverse (1342,20)GTCACCCACTGCAACCACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.548 kcal/mol
Forward Dimers-0.93 kcal/mol
Reverse Loops1.249 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.331 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCATTGCGATTGTCCAGAG
ACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTTGCAGTGGGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1171226 - 1342
Exon 7 To Exon 9 (Pair 6)
Forward (1205,23)CTTGCTACCCATTAGGATAATGTAmplicon SizecDNA: 209 bpgenomic: 6,132
Reverse (1413,20)GGCTGCTCACTGGCATTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops0.823 kcal/mol
Reverse Dimers-1.036 kcal/mol
Forward-Reverse Dimers-1.068 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceCTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATC
TGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCT
GTGGTTGCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGTCTGCTCCCCGC
CTCCAGGTCCCAAATGCCAGTGAGCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2091205 - 1413
Exon 7 To Exon 8 (Pair 21)
Forward (1204,23)ACTTGCTACCCATTAGGATAATGAmplicon SizecDNA: 137 bpgenomic: 4,702
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAAT
CTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCC
TGTGGTTGCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1371204 - 1340
Exon 7 To Exon 8 (Pair 22)
Forward (1210,24)TACCCATTAGGATAATGTCTTATGAmplicon SizecDNA: 131 bpgenomic: 4,696
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCA
TTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGT
TGCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1311210 - 1340
Exon 7 To Exon 9 (Pair 7)
Forward (1201,22)GCAACTTGCTACCCATTAGGATAmplicon SizecDNA: 217 bpgenomic: 6,140
Reverse (1417,21)TGTTGGCTGCTCACTGGCATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol in 3' area
Forward Dimers-0.731 kcal/mol
Reverse Loops0.823 kcal/mol in 3' area
Reverse Dimers-1.07 kcal/mol
Forward-Reverse Dimers-1.077 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGG
AATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATG
TCCTGTGGTTGCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGTCTGCTCC
CCGCCTCCAGGTCCCAAATGCCAGTGAGCAGCCAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2171201 - 1417
Exon 7 To Exon 8 (Pair 23)
Forward (1212,24)CCCATTAGGATAATGTCTTATGTAAmplicon SizecDNA: 130 bpgenomic: 4,695
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.531 kcal/mol
Forward Dimers-0.561 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceCCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCATT
GCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTTG
CAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1301212 - 1341
Exon 7 To Exon 8 (Pair 24)
Forward (1199,22)TTGCAACTTGCTACCCATTAGGAmplicon SizecDNA: 144 bpgenomic: 4,709
Reverse (1342,20)GTCACCCACTGCAACCACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.014 kcal/mol
Reverse Loops1.249 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.072 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGT
GGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGA
TGTCCTGTGGTTGCAGTGGGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1441199 - 1342
Exon 7 To Exon 9 (Pair 8)
Forward (1209,24)CTACCCATTAGGATAATGTCTTATAmplicon SizecDNA: 210 bpgenomic: 6,133
Reverse (1418,20)CTGTTGGCTGCTCACTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops0.823 kcal/mol in 3' area
Reverse Dimers-1.07 kcal/mol
Forward-Reverse Dimers-0.735 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCC
ATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGG
TTGCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGTCTGCTCCCCGCCTCC
AGGTCCCAAATGCCAGTGAGCAGCCAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2101209 - 1418
Exon 7 To Exon 9 (Pair 9)
Forward (1228,22)CTTATGTAATGCTGCCCTGTACAmplicon SizecDNA: 188 bpgenomic: 6,111
Reverse (1415,21)TTGGCTGCTCACTGGCATTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.548 kcal/mol
Forward Dimers-0.93 kcal/mol
Reverse Loops0.823 kcal/mol in 3' area
Reverse Dimers-1.07 kcal/mol
Forward-Reverse Dimers-2.762 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCATTGCGATTGTCCAGAGAC
TGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTTGCAGTGGGTGACCTCAC
AGGTGTTCACTCGAGTGCTGATGTGTCTGCTCCCCGCCTCCAGGTCCCAAATGCCAGTGA
GCAGCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1881228 - 1415
Exon 7 To Exon 9 (Pair 10)
Forward (1229,22)TTATGTAATGCTGCCCTGTACCAmplicon SizecDNA: 190 bpgenomic: 6,113
Reverse (1418,20)CTGTTGGCTGCTCACTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.548 kcal/mol
Forward Dimers-0.93 kcal/mol
Reverse Loops0.823 kcal/mol in 3' area
Reverse Dimers-1.07 kcal/mol
Forward-Reverse Dimers-2.762 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCATTGCGATTGTCCAGAGACT
GGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTTGCAGTGGGTGACCTCACA
GGTGTTCACTCGAGTGCTGATGTGTCTGCTCCCCGCCTCCAGGTCCCAAATGCCAGTGAG
CAGCCAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1901229 - 1418
Exon 7 To Exon 9 (Pair 11)
Forward (1208,23)GCTACCCATTAGGATAATGTCTTAmplicon SizecDNA: 211 bpgenomic: 6,134
Reverse (1418,20)CTGTTGGCTGCTCACTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops0.823 kcal/mol in 3' area
Reverse Dimers-1.07 kcal/mol
Forward-Reverse Dimers-0.735 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGC
CATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTG
GTTGCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGTCTGCTCCCCGCCTC
CAGGTCCCAAATGCCAGTGAGCAGCCAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2111208 - 1418
Exon 7 To Exon 8 (Pair 25)
Forward (1194,23)AAGATTTGCAACTTGCTACCCATAmplicon SizecDNA: 148 bpgenomic: 4,713
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceAAGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTG
CCTGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCC
GACGATGTCCTGTGGTTGCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1481194 - 1341
Exon 7 To Exon 9 (Pair 12)
Forward (1229,22)TTATGTAATGCTGCCCTGTACCAmplicon SizecDNA: 189 bpgenomic: 6,112
Reverse (1417,21)TGTTGGCTGCTCACTGGCATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.548 kcal/mol
Forward Dimers-0.93 kcal/mol
Reverse Loops0.823 kcal/mol in 3' area
Reverse Dimers-1.07 kcal/mol
Forward-Reverse Dimers-2.762 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCATTGCGATTGTCCAGAGACT
GGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTTGCAGTGGGTGACCTCACA
GGTGTTCACTCGAGTGCTGATGTGTCTGCTCCCCGCCTCCAGGTCCCAAATGCCAGTGAG
CAGCCAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1891229 - 1417
Exon 7 To Exon 8 (Pair 26)
Forward (1195,23)AGATTTGCAACTTGCTACCCATTAmplicon SizecDNA: 148 bpgenomic: 4,713
Reverse (1342,20)GTCACCCACTGCAACCACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.249 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceAGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGC
CTGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCG
ACGATGTCCTGTGGTTGCAGTGGGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1481195 - 1342
Exon 7 To Exon 9 (Pair 13)
Forward (1229,22)TTATGTAATGCTGCCCTGTACCAmplicon SizecDNA: 187 bpgenomic: 6,110
Reverse (1415,21)TTGGCTGCTCACTGGCATTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.548 kcal/mol
Forward Dimers-0.93 kcal/mol
Reverse Loops0.823 kcal/mol in 3' area
Reverse Dimers-1.07 kcal/mol
Forward-Reverse Dimers-2.762 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCATTGCGATTGTCCAGAGACT
GGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTTGCAGTGGGTGACCTCACA
GGTGTTCACTCGAGTGCTGATGTGTCTGCTCCCCGCCTCCAGGTCCCAAATGCCAGTGAG
CAGCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1871229 - 1415
Exon 7 To Exon 8 (Pair 27)
Forward (1200,22)TGCAACTTGCTACCCATTAGGAAmplicon SizecDNA: 140 bpgenomic: 4,705
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol in 3' area
Forward Dimers-1.273 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.671 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTG
GAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGAT
GTCCTGTGGTTGCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1401200 - 1339
Exon 7 To Exon 8 (Pair 28)
Forward (1211,24)ACCCATTAGGATAATGTCTTATGTAmplicon SizecDNA: 130 bpgenomic: 4,695
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCAT
TGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTT
GCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1301211 - 1340
Exon 7 To Exon 8 (Pair 29)
Forward (1209,24)CTACCCATTAGGATAATGTCTTATAmplicon SizecDNA: 133 bpgenomic: 4,698
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCC
ATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGG
TTGCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1331209 - 1341
Exon 7 To Exon 8 (Pair 30)
Forward (1207,23)TGCTACCCATTAGGATAATGTCTAmplicon SizecDNA: 134 bpgenomic: 4,699
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTG
CCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGT
GGTTGCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1341207 - 1340
Exon 7 To Exon 8 (Pair 31)
Forward (1206,23)TTGCTACCCATTAGGATAATGTCAmplicon SizecDNA: 135 bpgenomic: 4,700
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCT
GCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTG
TGGTTGCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1351206 - 1340
Exon 7 To Exon 8 (Pair 32)
Forward (1212,24)CCCATTAGGATAATGTCTTATGTAAmplicon SizecDNA: 128 bpgenomic: 4,693
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.531 kcal/mol
Forward Dimers-0.561 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceCCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCATT
GCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTTG
CAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1281212 - 1339
Exon 7 To Exon 8 (Pair 33)
Forward (1201,22)GCAACTTGCTACCCATTAGGATAmplicon SizecDNA: 141 bpgenomic: 4,706
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol in 3' area
Forward Dimers-0.731 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGG
AATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATG
TCCTGTGGTTGCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1411201 - 1341
Exon 7 To Exon 8 (Pair 34)
Forward (1199,22)TTGCAACTTGCTACCCATTAGGAmplicon SizecDNA: 143 bpgenomic: 4,708
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.014 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.072 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGT
GGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGA
TGTCCTGTGGTTGCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1431199 - 1341
Exon 7 To Exon 8 (Pair 35)
Forward (1193,22)CAAGATTTGCAACTTGCTACCCAmplicon SizecDNA: 148 bpgenomic: 4,713
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceCAAGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCT
GCCTGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCC
CGACGATGTCCTGTGGTTGCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1481193 - 1340
Exon 7 To Exon 9 (Pair 14)
Forward (1193,22)CAAGATTTGCAACTTGCTACCCAmplicon SizecDNA: 221 bpgenomic: 6,144
Reverse (1413,20)GGCTGCTCACTGGCATTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops0.823 kcal/mol
Reverse Dimers-1.036 kcal/mol
Forward-Reverse Dimers-1.322 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceCAAGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCT
GCCTGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCC
CGACGATGTCCTGTGGTTGCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTG
TCTGCTCCCCGCCTCCAGGTCCCAAATGCCAGTGAGCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2211193 - 1413
Exon 7 To Exon 8 (Pair 36)
Forward (1209,24)CTACCCATTAGGATAATGTCTTATAmplicon SizecDNA: 131 bpgenomic: 4,696
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCC
ATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGG
TTGCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1311209 - 1339
Exon 7 To Exon 8 (Pair 37)
Forward (1196,23)GATTTGCAACTTGCTACCCATTAAmplicon SizecDNA: 146 bpgenomic: 4,711
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCC
TGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGA
CGATGTCCTGTGGTTGCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1461196 - 1341
Exon 7 To Exon 9 (Pair 15)
Forward (1195,23)AGATTTGCAACTTGCTACCCATTAmplicon SizecDNA: 219 bpgenomic: 6,142
Reverse (1413,20)GGCTGCTCACTGGCATTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops0.823 kcal/mol
Reverse Dimers-1.036 kcal/mol
Forward-Reverse Dimers-1.322 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceAGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGC
CTGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCG
ACGATGTCCTGTGGTTGCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGTC
TGCTCCCCGCCTCCAGGTCCCAAATGCCAGTGAGCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2191195 - 1413
Exon 7 To Exon 8 (Pair 38)
Forward (1200,22)TGCAACTTGCTACCCATTAGGAAmplicon SizecDNA: 141 bpgenomic: 4,706
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol in 3' area
Forward Dimers-1.273 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.671 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTG
GAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGAT
GTCCTGTGGTTGCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1411200 - 1340
Exon 7 To Exon 8 (Pair 39)
Forward (1208,23)GCTACCCATTAGGATAATGTCTTAmplicon SizecDNA: 133 bpgenomic: 4,698
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGC
CATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTG
GTTGCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1331208 - 1340
Exon 7 To Exon 9 (Pair 16)
Forward (1199,22)TTGCAACTTGCTACCCATTAGGAmplicon SizecDNA: 215 bpgenomic: 6,138
Reverse (1413,20)GGCTGCTCACTGGCATTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.014 kcal/mol
Reverse Loops0.823 kcal/mol
Reverse Dimers-1.036 kcal/mol
Forward-Reverse Dimers-1.322 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGT
GGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGA
TGTCCTGTGGTTGCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGTCTGCT
CCCCGCCTCCAGGTCCCAAATGCCAGTGAGCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2151199 - 1413
Exon 7 To Exon 8 (Pair 40)
Forward (1194,23)AAGATTTGCAACTTGCTACCCATAmplicon SizecDNA: 147 bpgenomic: 4,712
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceAAGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTG
CCTGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCC
GACGATGTCCTGTGGTTGCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1471194 - 1340
Exon 7 To Exon 8 (Pair 41)
Forward (1197,23)ATTTGCAACTTGCTACCCATTAGAmplicon SizecDNA: 144 bpgenomic: 4,709
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCT
GTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGAC
GATGTCCTGTGGTTGCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1441197 - 1340
Exon 7 To Exon 8 (Pair 42)
Forward (1210,24)TACCCATTAGGATAATGTCTTATGAmplicon SizecDNA: 132 bpgenomic: 4,697
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCA
TTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGT
TGCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1321210 - 1341
Exon 7 To Exon 9 (Pair 17)
Forward (1204,23)ACTTGCTACCCATTAGGATAATGAmplicon SizecDNA: 210 bpgenomic: 6,133
Reverse (1413,20)GGCTGCTCACTGGCATTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops0.823 kcal/mol
Reverse Dimers-1.036 kcal/mol
Forward-Reverse Dimers-1.068 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAAT
CTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCC
TGTGGTTGCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGTCTGCTCCCCG
CCTCCAGGTCCCAAATGCCAGTGAGCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2101204 - 1413
Exon 7 To Exon 9 (Pair 18)
Forward (1211,24)ACCCATTAGGATAATGTCTTATGTAmplicon SizecDNA: 208 bpgenomic: 6,131
Reverse (1418,20)CTGTTGGCTGCTCACTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops0.823 kcal/mol in 3' area
Reverse Dimers-1.07 kcal/mol
Forward-Reverse Dimers-0.735 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCAT
TGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTT
GCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGTCTGCTCCCCGCCTCCAG
GTCCCAAATGCCAGTGAGCAGCCAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2081211 - 1418
Exon 7 To Exon 8 (Pair 43)
Forward (1197,23)ATTTGCAACTTGCTACCCATTAGAmplicon SizecDNA: 145 bpgenomic: 4,710
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCT
GTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGAC
GATGTCCTGTGGTTGCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1451197 - 1341
Exon 7 To Exon 9 (Pair 19)
Forward (1212,24)CCCATTAGGATAATGTCTTATGTAAmplicon SizecDNA: 207 bpgenomic: 6,130
Reverse (1418,20)CTGTTGGCTGCTCACTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.531 kcal/mol
Forward Dimers-0.561 kcal/mol
Reverse Loops0.823 kcal/mol in 3' area
Reverse Dimers-1.07 kcal/mol
Forward-Reverse Dimers-0.735 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceCCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCATT
GCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTTG
CAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGTCTGCTCCCCGCCTCCAGG
TCCCAAATGCCAGTGAGCAGCCAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2071212 - 1418
Exon 7 To Exon 8 (Pair 44)
Forward (1199,22)TTGCAACTTGCTACCCATTAGGAmplicon SizecDNA: 142 bpgenomic: 4,707
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.014 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.072 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGT
GGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGA
TGTCCTGTGGTTGCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1421199 - 1340
Exon 7 To Exon 8 (Pair 45)
Forward (1193,22)CAAGATTTGCAACTTGCTACCCAmplicon SizecDNA: 150 bpgenomic: 4,715
Reverse (1342,20)GTCACCCACTGCAACCACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.249 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceCAAGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCT
GCCTGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCC
CGACGATGTCCTGTGGTTGCAGTGGGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1501193 - 1342
Exon 7 To Exon 8 (Pair 46)
Forward (1207,23)TGCTACCCATTAGGATAATGTCTAmplicon SizecDNA: 133 bpgenomic: 4,698
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTG
CCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGT
GGTTGCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1331207 - 1339
Exon 7 To Exon 8 (Pair 47)
Forward (1196,23)GATTTGCAACTTGCTACCCATTAAmplicon SizecDNA: 144 bpgenomic: 4,709
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCC
TGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGA
CGATGTCCTGTGGTTGCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1441196 - 1339
Exon 7 To Exon 8 (Pair 48)
Forward (1196,23)GATTTGCAACTTGCTACCCATTAAmplicon SizecDNA: 145 bpgenomic: 4,710
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCC
TGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGA
CGATGTCCTGTGGTTGCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1451196 - 1340
Exon 7 To Exon 8 (Pair 49)
Forward (1206,23)TTGCTACCCATTAGGATAATGTCAmplicon SizecDNA: 136 bpgenomic: 4,701
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCT
GCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTG
TGGTTGCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1361206 - 1341
Exon 7 To Exon 9 (Pair 20)
Forward (1229,22)TTATGTAATGCTGCCCTGTACCAmplicon SizecDNA: 188 bpgenomic: 6,111
Reverse (1416,21)GTTGGCTGCTCACTGGCATTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.548 kcal/mol
Forward Dimers-0.93 kcal/mol
Reverse Loops0.823 kcal/mol in 3' area
Reverse Dimers-1.07 kcal/mol
Forward-Reverse Dimers-2.762 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCATTGCGATTGTCCAGAGACT
GGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTTGCAGTGGGTGACCTCACA
GGTGTTCACTCGAGTGCTGATGTGTCTGCTCCCCGCCTCCAGGTCCCAAATGCCAGTGAG
CAGCCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1881229 - 1416
Exon 7 To Exon 8 (Pair 50)
Forward (1206,23)TTGCTACCCATTAGGATAATGTCAmplicon SizecDNA: 134 bpgenomic: 4,699
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCT
GCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTG
TGGTTGCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1341206 - 1339
Exon 7 To Exon 8 (Pair 51)
Forward (1211,24)ACCCATTAGGATAATGTCTTATGTAmplicon SizecDNA: 131 bpgenomic: 4,696
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCAT
TGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTT
GCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1311211 - 1341
Exon 7 To Exon 8 (Pair 52)
Forward (1193,22)CAAGATTTGCAACTTGCTACCCAmplicon SizecDNA: 147 bpgenomic: 4,712
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceCAAGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCT
GCCTGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCC
CGACGATGTCCTGTGGTTGCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1471193 - 1339
Exon 7 To Exon 9 (Pair 21)
Forward (1228,22)CTTATGTAATGCTGCCCTGTACAmplicon SizecDNA: 190 bpgenomic: 6,113
Reverse (1417,21)TGTTGGCTGCTCACTGGCATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.548 kcal/mol
Forward Dimers-0.93 kcal/mol
Reverse Loops0.823 kcal/mol in 3' area
Reverse Dimers-1.07 kcal/mol
Forward-Reverse Dimers-2.762 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCATTGCGATTGTCCAGAGAC
TGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTTGCAGTGGGTGACCTCAC
AGGTGTTCACTCGAGTGCTGATGTGTCTGCTCCCCGCCTCCAGGTCCCAAATGCCAGTGA
GCAGCCAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1901228 - 1417
Exon 7 To Exon 8 (Pair 53)
Forward (1201,22)GCAACTTGCTACCCATTAGGATAmplicon SizecDNA: 139 bpgenomic: 4,704
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol in 3' area
Forward Dimers-0.731 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGG
AATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATG
TCCTGTGGTTGCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1391201 - 1339
Exon 7 To Exon 8 (Pair 54)
Forward (1210,24)TACCCATTAGGATAATGTCTTATGAmplicon SizecDNA: 130 bpgenomic: 4,695
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCA
TTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGT
TGCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1301210 - 1339
Exon 7 To Exon 9 (Pair 22)
Forward (1228,22)CTTATGTAATGCTGCCCTGTACAmplicon SizecDNA: 191 bpgenomic: 6,114
Reverse (1418,20)CTGTTGGCTGCTCACTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.548 kcal/mol
Forward Dimers-0.93 kcal/mol
Reverse Loops0.823 kcal/mol in 3' area
Reverse Dimers-1.07 kcal/mol
Forward-Reverse Dimers-2.762 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGCCATTGCGATTGTCCAGAGAC
TGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTGGTTGCAGTGGGTGACCTCAC
AGGTGTTCACTCGAGTGCTGATGTGTCTGCTCCCCGCCTCCAGGTCCCAAATGCCAGTGA
GCAGCCAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1911228 - 1418
Exon 7 To Exon 8 (Pair 55)
Forward (1204,23)ACTTGCTACCCATTAGGATAATGAmplicon SizecDNA: 139 bpgenomic: 4,704
Reverse (1342,20)GTCACCCACTGCAACCACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.249 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAAT
CTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCC
TGTGGTTGCAGTGGGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1391204 - 1342
Exon 7 To Exon 9 (Pair 23)
Forward (1201,22)GCAACTTGCTACCCATTAGGATAmplicon SizecDNA: 213 bpgenomic: 6,136
Reverse (1413,20)GGCTGCTCACTGGCATTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol in 3' area
Forward Dimers-0.731 kcal/mol
Reverse Loops0.823 kcal/mol
Reverse Dimers-1.036 kcal/mol
Forward-Reverse Dimers-1.068 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGG
AATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATG
TCCTGTGGTTGCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGTCTGCTCC
CCGCCTCCAGGTCCCAAATGCCAGTGAGCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2131201 - 1413
Exon 7 To Exon 8 (Pair 56)
Forward (1195,23)AGATTTGCAACTTGCTACCCATTAmplicon SizecDNA: 146 bpgenomic: 4,711
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceAGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGC
CTGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCG
ACGATGTCCTGTGGTTGCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1461195 - 1340
Exon 7 To Exon 8 (Pair 57)
Forward (1208,23)GCTACCCATTAGGATAATGTCTTAmplicon SizecDNA: 134 bpgenomic: 4,699
Reverse (1341,20)TCACCCACTGCAACCACAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCTGC
CATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTGTG
GTTGCAGTGGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1341208 - 1341
Exon 7 To Exon 8 (Pair 58)
Forward (1201,22)GCAACTTGCTACCCATTAGGATAmplicon SizecDNA: 140 bpgenomic: 4,705
Reverse (1340,20)CACCCACTGCAACCACAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol in 3' area
Forward Dimers-0.731 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGG
AATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATG
TCCTGTGGTTGCAGTGGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1401201 - 1340
Exon 7 To Exon 9 (Pair 24)
Forward (1200,22)TGCAACTTGCTACCCATTAGGAAmplicon SizecDNA: 214 bpgenomic: 6,137
Reverse (1413,20)GGCTGCTCACTGGCATTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol in 3' area
Forward Dimers-1.273 kcal/mol
Reverse Loops0.823 kcal/mol
Reverse Dimers-1.036 kcal/mol
Forward-Reverse Dimers-1.251 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTG
GAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGAT
GTCCTGTGGTTGCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGTCTGCTC
CCCGCCTCCAGGTCCCAAATGCCAGTGAGCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2141200 - 1413
Exon 7 To Exon 8 (Pair 59)
Forward (1197,23)ATTTGCAACTTGCTACCCATTAGAmplicon SizecDNA: 146 bpgenomic: 4,711
Reverse (1342,20)GTCACCCACTGCAACCACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops1.249 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCT
GTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGAC
GATGTCCTGTGGTTGCAGTGGGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1461197 - 1342
Exon 7 To Exon 8 (Pair 60)
Forward (1206,23)TTGCTACCCATTAGGATAATGTCAmplicon SizecDNA: 137 bpgenomic: 4,702
Reverse (1342,20)GTCACCCACTGCAACCACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.249 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATCT
GCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCTG
TGGTTGCAGTGGGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1371206 - 1342
Exon 7 To Exon 8 (Pair 61)
Forward (1204,23)ACTTGCTACCCATTAGGATAATGAmplicon SizecDNA: 136 bpgenomic: 4,701
Reverse (1339,20)ACCCACTGCAACCACAGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAAT
CTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCC
TGTGGTTGCAGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1361204 - 1339
Exon 7 To Exon 8 (Pair 62)
Forward (1200,22)TGCAACTTGCTACCCATTAGGAAmplicon SizecDNA: 143 bpgenomic: 4,708
Reverse (1342,20)GTCACCCACTGCAACCACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol in 3' area
Forward Dimers-1.273 kcal/mol
Reverse Loops1.249 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.671 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTG
GAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGAT
GTCCTGTGGTTGCAGTGGGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1431200 - 1342
Exon 7 To Exon 9 (Pair 25)
Forward (1194,23)AAGATTTGCAACTTGCTACCCATAmplicon SizecDNA: 220 bpgenomic: 6,143
Reverse (1413,20)GGCTGCTCACTGGCATTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.709 kcal/mol
Forward Dimers-2.156 kcal/mol
Reverse Loops0.823 kcal/mol
Reverse Dimers-1.036 kcal/mol
Forward-Reverse Dimers-1.322 kcal/mol
Amplicon Folding-0.733 kcal/mol outside primersite
Amplicon SequenceAAGATTTGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTG
CCTGTGGAATCTGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCC
GACGATGTCCTGTGGTTGCAGTGGGTGACCTCACAGGTGTTCACTCGAGTGCTGATGTGT
CTGCTCCCCGCCTCCAGGTCCCAAATGCCAGTGAGCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)2201194 - 1413
Exon 7 To Exon 8 (Pair 63)
Forward (1205,23)CTTGCTACCCATTAGGATAATGTAmplicon SizecDNA: 138 bpgenomic: 4,703
Reverse (1342,20)GTCACCCACTGCAACCACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.17 kcal/mol
Forward Dimers-0.59 kcal/mol
Reverse Loops1.249 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.431 kcal/mol
Amplicon Folding-0.12 kcal/mol outside primersite
Amplicon SequenceCTTGCTACCCATTAGGATAATGTCTTATGTAATGCTGCCCTGTACCCTGCCTGTGGAATC
TGCCATTGCGATTGTCCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGATGTCCT
GTGGTTGCAGTGGGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_025225 (PNPLA3)1381205 - 1342
 

See below for some more details.

Program Output:

Loading ...