Design Results for rnpc3

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size200Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 4 To Exon 7 (Pair 1)
Forward (483,23)ACCCTGTCGAAGATGATAAAGAAAmplicon SizecDNA: 301 bpgenomic: 2,604
Reverse (783,20)GATGTGGGTGGAAGAGGTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.644 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops2.458 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-2.398 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceACCCTGTCGAAGATGATAAAGAAAAAAAAGAACTTGGTTATTTAACAGTAGAAAATGGAA
TTGCACCAAACCATGGGCTGACTTTTCCTTTAAATTCATGCCTCAAGTATATGTACCCAC
CACCTTCCAGCACAATCCTAGCAAACATTGTAAATGCCTTGGCAAGCGTGCCTAAGTTCT
ATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCACACCTTTTGGACCAATTA
CTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATGCACCTCTTCCACCCACAT
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)301483 - 783
Exon 5 To Exon 7 (Pair 1)
Forward (577,23)TTCATGCCTCAAGTATATGTACCAmplicon SizecDNA: 220 bpgenomic: 2,051
Reverse (796,20)AGGTGGCTGAGGAGATGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.718 kcal/mol
Forward Dimers-0.618 kcal/mol
Reverse Loops1.503 kcal/mol
Reverse Dimers-1.715 kcal/mol
Forward-Reverse Dimers-2.996 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceTTCATGCCTCAAGTATATGTACCCACCACCTTCCAGCACAATCCTAGCAAACATTGTAAA
TGCCTTGGCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAA
TTTGCCCACACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCC
ATTGCATGCACCTCTTCCACCCACATCTCCTCAGCCACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)220577 - 796
Exon 5 To Exon 8 (Pair 1)
Forward (647,22)AGCGTGCCTAAGTTCTATGTACAmplicon SizecDNA: 270 bpgenomic: 5,966
Reverse (916,24)CTGAAGATTTGCTAGTTCCATTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.781 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.092 kcal/mol
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-1.374 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCACA
CCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATGCA
CCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATGAG
GAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATG
AACAAATTAATGGAACTAGCAAATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)270647 - 916
Exon 5 To Exon 7 (Pair 2)
Forward (569,24)CCTTTAAATTCATGCCTCAAGTATAmplicon SizecDNA: 225 bpgenomic: 2,056
Reverse (793,20)TGGCTGAGGAGATGTGGGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.16 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops1.503 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-2.996 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceCCTTTAAATTCATGCCTCAAGTATATGTACCCACCACCTTCCAGCACAATCCTAGCAAAC
ATTGTAAATGCCTTGGCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAAT
AAAATGAATTTGCCCACACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGAC
TATATGCCATTGCATGCACCTCTTCCACCCACATCTCCTCAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)225569 - 793
Exon 5 To Exon 7 (Pair 3)
Forward (645,22)CAAGCGTGCCTAAGTTCTATGTAmplicon SizecDNA: 215 bpgenomic: 2,046
Reverse (859,24)GCTTTCATATTCTGATTCTTCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.24 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.43 kcal/mol
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-1.832 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCA
CACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATG
CACCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATG
AGGAATTATCTAGTGAAGAATCAGAATATGAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)215645 - 859
Exon 5 To Exon 7 (Pair 4)
Forward (645,22)CAAGCGTGCCTAAGTTCTATGTAmplicon SizecDNA: 229 bpgenomic: 2,060
Reverse (873,23)TCCTCATCATCAGTGCTTTCATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.24 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops2.082 kcal/mol
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-2.356 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCA
CACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATG
CACCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATG
AGGAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)229645 - 873
Exon 5 To Exon 7 (Pair 5)
Forward (645,22)CAAGCGTGCCTAAGTTCTATGTAmplicon SizecDNA: 218 bpgenomic: 2,049
Reverse (862,24)AGTGCTTTCATATTCTGATTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.24 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.43 kcal/mol
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-2.356 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCA
CACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATG
CACCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATG
AGGAATTATCTAGTGAAGAATCAGAATATGAAAGCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)218645 - 862
Exon 5 To Exon 7 (Pair 6)
Forward (647,22)AGCGTGCCTAAGTTCTATGTACAmplicon SizecDNA: 224 bpgenomic: 2,055
Reverse (870,24)TCATCATCAGTGCTTTCATATTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.781 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops2.082 kcal/mol
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.437 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCACA
CCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATGCA
CCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATGAG
GAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)224647 - 870
Exon 5 To Exon 7 (Pair 7)
Forward (647,22)AGCGTGCCTAAGTTCTATGTACAmplicon SizecDNA: 216 bpgenomic: 2,047
Reverse (862,24)AGTGCTTTCATATTCTGATTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.781 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.43 kcal/mol
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-1.437 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCACA
CCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATGCA
CCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATGAG
GAATTATCTAGTGAAGAATCAGAATATGAAAGCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)216647 - 862
Exon 5 To Exon 7 (Pair 8)
Forward (647,22)AGCGTGCCTAAGTTCTATGTACAmplicon SizecDNA: 215 bpgenomic: 2,046
Reverse (861,24)GTGCTTTCATATTCTGATTCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.781 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.43 kcal/mol
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-1.437 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCACA
CCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATGCA
CCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATGAG
GAATTATCTAGTGAAGAATCAGAATATGAAAGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)215647 - 861
Exon 5 To Exon 7 (Pair 9)
Forward (569,24)CCTTTAAATTCATGCCTCAAGTATAmplicon SizecDNA: 226 bpgenomic: 2,057
Reverse (794,20)GTGGCTGAGGAGATGTGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.16 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops1.503 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-2.996 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceCCTTTAAATTCATGCCTCAAGTATATGTACCCACCACCTTCCAGCACAATCCTAGCAAAC
ATTGTAAATGCCTTGGCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAAT
AAAATGAATTTGCCCACACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGAC
TATATGCCATTGCATGCACCTCTTCCACCCACATCTCCTCAGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)226569 - 794
Exon 5 To Exon 7 (Pair 10)
Forward (577,23)TTCATGCCTCAAGTATATGTACCAmplicon SizecDNA: 215 bpgenomic: 2,046
Reverse (791,20)GCTGAGGAGATGTGGGTGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.718 kcal/mol
Forward Dimers-0.618 kcal/mol
Reverse Loops1.503 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-2.996 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceTTCATGCCTCAAGTATATGTACCCACCACCTTCCAGCACAATCCTAGCAAACATTGTAAA
TGCCTTGGCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAA
TTTGCCCACACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCC
ATTGCATGCACCTCTTCCACCCACATCTCCTCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)215577 - 791
Exon 5 To Exon 8 (Pair 2)
Forward (645,22)CAAGCGTGCCTAAGTTCTATGTAmplicon SizecDNA: 272 bpgenomic: 5,968
Reverse (916,24)CTGAAGATTTGCTAGTTCCATTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.24 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.092 kcal/mol
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCA
CACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATG
CACCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATG
AGGAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAA
TGAACAAATTAATGGAACTAGCAAATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)272645 - 916
Exon 5 To Exon 7 (Pair 11)
Forward (645,22)CAAGCGTGCCTAAGTTCTATGTAmplicon SizecDNA: 228 bpgenomic: 2,059
Reverse (872,23)CCTCATCATCAGTGCTTTCATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.24 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops2.082 kcal/mol
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-2.356 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCA
CACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATG
CACCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATG
AGGAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)228645 - 872
Exon 5 To Exon 7 (Pair 12)
Forward (647,22)AGCGTGCCTAAGTTCTATGTACAmplicon SizecDNA: 222 bpgenomic: 2,053
Reverse (868,24)ATCATCAGTGCTTTCATATTCTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.781 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.43 kcal/mol in 3' area
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.437 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCACA
CCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATGCA
CCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATGAG
GAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)222647 - 868
Exon 5 To Exon 7 (Pair 13)
Forward (577,23)TTCATGCCTCAAGTATATGTACCAmplicon SizecDNA: 218 bpgenomic: 2,049
Reverse (794,20)GTGGCTGAGGAGATGTGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.718 kcal/mol
Forward Dimers-0.618 kcal/mol
Reverse Loops1.503 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-2.996 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceTTCATGCCTCAAGTATATGTACCCACCACCTTCCAGCACAATCCTAGCAAACATTGTAAA
TGCCTTGGCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAA
TTTGCCCACACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCC
ATTGCATGCACCTCTTCCACCCACATCTCCTCAGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)218577 - 794
Exon 5 To Exon 8 (Pair 3)
Forward (647,22)AGCGTGCCTAAGTTCTATGTACAmplicon SizecDNA: 271 bpgenomic: 5,967
Reverse (917,23)GCTGAAGATTTGCTAGTTCCATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.781 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.092 kcal/mol
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-1.374 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCACA
CCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATGCA
CCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATGAG
GAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATG
AACAAATTAATGGAACTAGCAAATCTTCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)271647 - 917
Exon 5 To Exon 7 (Pair 14)
Forward (645,22)CAAGCGTGCCTAAGTTCTATGTAmplicon SizecDNA: 226 bpgenomic: 2,057
Reverse (870,24)TCATCATCAGTGCTTTCATATTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.24 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops2.082 kcal/mol
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-2.356 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCA
CACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATG
CACCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATG
AGGAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)226645 - 870
Exon 5 To Exon 8 (Pair 4)
Forward (647,22)AGCGTGCCTAAGTTCTATGTACAmplicon SizecDNA: 274 bpgenomic: 5,970
Reverse (920,22)TGGGCTGAAGATTTGCTAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.781 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.092 kcal/mol
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-1.766 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCACA
CCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATGCA
CCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATGAG
GAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATG
AACAAATTAATGGAACTAGCAAATCTTCAGCCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)274647 - 920
Exon 5 To Exon 7 (Pair 15)
Forward (647,22)AGCGTGCCTAAGTTCTATGTACAmplicon SizecDNA: 217 bpgenomic: 2,048
Reverse (863,24)CAGTGCTTTCATATTCTGATTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.781 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.43 kcal/mol
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.437 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCACA
CCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATGCA
CCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATGAG
GAATTATCTAGTGAAGAATCAGAATATGAAAGCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)217647 - 863
Exon 5 To Exon 7 (Pair 16)
Forward (575,24)AATTCATGCCTCAAGTATATGTACAmplicon SizecDNA: 215 bpgenomic: 2,046
Reverse (789,21)TGAGGAGATGTGGGTGGAAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.718 kcal/mol
Forward Dimers-0.618 kcal/mol
Reverse Loops2.458 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-2.996 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceAATTCATGCCTCAAGTATATGTACCCACCACCTTCCAGCACAATCCTAGCAAACATTGTA
AATGCCTTGGCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATG
AATTTGCCCACACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATG
CCATTGCATGCACCTCTTCCACCCACATCTCCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)215575 - 789
Exon 5 To Exon 7 (Pair 17)
Forward (575,24)AATTCATGCCTCAAGTATATGTACAmplicon SizecDNA: 222 bpgenomic: 2,053
Reverse (796,20)AGGTGGCTGAGGAGATGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.718 kcal/mol
Forward Dimers-0.618 kcal/mol
Reverse Loops1.503 kcal/mol
Reverse Dimers-1.715 kcal/mol
Forward-Reverse Dimers-2.996 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceAATTCATGCCTCAAGTATATGTACCCACCACCTTCCAGCACAATCCTAGCAAACATTGTA
AATGCCTTGGCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATG
AATTTGCCCACACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATG
CCATTGCATGCACCTCTTCCACCCACATCTCCTCAGCCACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)222575 - 796
Exon 5 To Exon 8 (Pair 5)
Forward (645,22)CAAGCGTGCCTAAGTTCTATGTAmplicon SizecDNA: 273 bpgenomic: 5,969
Reverse (917,23)GCTGAAGATTTGCTAGTTCCATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.24 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.092 kcal/mol
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCA
CACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATG
CACCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATG
AGGAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAA
TGAACAAATTAATGGAACTAGCAAATCTTCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)273645 - 917
Exon 5 To Exon 8 (Pair 6)
Forward (645,22)CAAGCGTGCCTAAGTTCTATGTAmplicon SizecDNA: 276 bpgenomic: 5,972
Reverse (920,22)TGGGCTGAAGATTTGCTAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.24 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.092 kcal/mol
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCA
CACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATG
CACCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATG
AGGAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAA
TGAACAAATTAATGGAACTAGCAAATCTTCAGCCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)276645 - 920
Exon 5 To Exon 7 (Pair 18)
Forward (577,23)TTCATGCCTCAAGTATATGTACCAmplicon SizecDNA: 217 bpgenomic: 2,048
Reverse (793,20)TGGCTGAGGAGATGTGGGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.718 kcal/mol
Forward Dimers-0.618 kcal/mol
Reverse Loops1.503 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-2.996 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceTTCATGCCTCAAGTATATGTACCCACCACCTTCCAGCACAATCCTAGCAAACATTGTAAA
TGCCTTGGCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAA
TTTGCCCACACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCC
ATTGCATGCACCTCTTCCACCCACATCTCCTCAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)217577 - 793
Exon 5 To Exon 7 (Pair 19)
Forward (575,24)AATTCATGCCTCAAGTATATGTACAmplicon SizecDNA: 219 bpgenomic: 2,050
Reverse (793,20)TGGCTGAGGAGATGTGGGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.718 kcal/mol
Forward Dimers-0.618 kcal/mol
Reverse Loops1.503 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-2.996 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceAATTCATGCCTCAAGTATATGTACCCACCACCTTCCAGCACAATCCTAGCAAACATTGTA
AATGCCTTGGCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATG
AATTTGCCCACACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATG
CCATTGCATGCACCTCTTCCACCCACATCTCCTCAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)219575 - 793
Exon 5 To Exon 7 (Pair 20)
Forward (577,23)TTCATGCCTCAAGTATATGTACCAmplicon SizecDNA: 213 bpgenomic: 2,044
Reverse (789,21)TGAGGAGATGTGGGTGGAAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.718 kcal/mol
Forward Dimers-0.618 kcal/mol
Reverse Loops2.458 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-2.996 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceTTCATGCCTCAAGTATATGTACCCACCACCTTCCAGCACAATCCTAGCAAACATTGTAAA
TGCCTTGGCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAA
TTTGCCCACACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCC
ATTGCATGCACCTCTTCCACCCACATCTCCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)213577 - 789
Exon 5 To Exon 7 (Pair 21)
Forward (645,22)CAAGCGTGCCTAAGTTCTATGTAmplicon SizecDNA: 224 bpgenomic: 2,055
Reverse (868,24)ATCATCAGTGCTTTCATATTCTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.24 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.43 kcal/mol in 3' area
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-2.356 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCA
CACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATG
CACCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATG
AGGAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)224645 - 868
Exon 5 To Exon 7 (Pair 22)
Forward (647,22)AGCGTGCCTAAGTTCTATGTACAmplicon SizecDNA: 214 bpgenomic: 2,045
Reverse (860,24)TGCTTTCATATTCTGATTCTTCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.781 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.43 kcal/mol
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-1.359 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCACA
CCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATGCA
CCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATGAG
GAATTATCTAGTGAAGAATCAGAATATGAAAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)214647 - 860
Exon 5 To Exon 7 (Pair 23)
Forward (569,24)CCTTTAAATTCATGCCTCAAGTATAmplicon SizecDNA: 221 bpgenomic: 2,052
Reverse (789,21)TGAGGAGATGTGGGTGGAAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.16 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops2.458 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-2.996 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceCCTTTAAATTCATGCCTCAAGTATATGTACCCACCACCTTCCAGCACAATCCTAGCAAAC
ATTGTAAATGCCTTGGCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAAT
AAAATGAATTTGCCCACACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGAC
TATATGCCATTGCATGCACCTCTTCCACCCACATCTCCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)221569 - 789
Exon 5 To Exon 7 (Pair 24)
Forward (647,22)AGCGTGCCTAAGTTCTATGTACAmplicon SizecDNA: 226 bpgenomic: 2,057
Reverse (872,23)CCTCATCATCAGTGCTTTCATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.781 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops2.082 kcal/mol
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.437 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCACA
CCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATGCA
CCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATGAG
GAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)226647 - 872
Exon 5 To Exon 7 (Pair 25)
Forward (575,24)AATTCATGCCTCAAGTATATGTACAmplicon SizecDNA: 220 bpgenomic: 2,051
Reverse (794,20)GTGGCTGAGGAGATGTGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.718 kcal/mol
Forward Dimers-0.618 kcal/mol
Reverse Loops1.503 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-2.996 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceAATTCATGCCTCAAGTATATGTACCCACCACCTTCCAGCACAATCCTAGCAAACATTGTA
AATGCCTTGGCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATG
AATTTGCCCACACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATG
CCATTGCATGCACCTCTTCCACCCACATCTCCTCAGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)220575 - 794
Exon 5 To Exon 7 (Pair 26)
Forward (645,22)CAAGCGTGCCTAAGTTCTATGTAmplicon SizecDNA: 219 bpgenomic: 2,050
Reverse (863,24)CAGTGCTTTCATATTCTGATTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.24 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.43 kcal/mol
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-2.356 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCA
CACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATG
CACCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATG
AGGAATTATCTAGTGAAGAATCAGAATATGAAAGCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)219645 - 863
Exon 5 To Exon 7 (Pair 27)
Forward (569,24)CCTTTAAATTCATGCCTCAAGTATAmplicon SizecDNA: 223 bpgenomic: 2,054
Reverse (791,20)GCTGAGGAGATGTGGGTGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.16 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops1.503 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-2.996 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceCCTTTAAATTCATGCCTCAAGTATATGTACCCACCACCTTCCAGCACAATCCTAGCAAAC
ATTGTAAATGCCTTGGCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAAT
AAAATGAATTTGCCCACACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGAC
TATATGCCATTGCATGCACCTCTTCCACCCACATCTCCTCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)223569 - 791
Exon 5 To Exon 7 (Pair 28)
Forward (647,22)AGCGTGCCTAAGTTCTATGTACAmplicon SizecDNA: 218 bpgenomic: 2,049
Reverse (864,24)TCAGTGCTTTCATATTCTGATTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.781 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.43 kcal/mol
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.437 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCACA
CCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATGCA
CCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATGAG
GAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)218647 - 864
Exon 5 To Exon 7 (Pair 29)
Forward (645,22)CAAGCGTGCCTAAGTTCTATGTAmplicon SizecDNA: 216 bpgenomic: 2,047
Reverse (860,24)TGCTTTCATATTCTGATTCTTCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.24 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.43 kcal/mol
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-2.278 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCA
CACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATG
CACCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATG
AGGAATTATCTAGTGAAGAATCAGAATATGAAAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)216645 - 860
Exon 5 To Exon 7 (Pair 30)
Forward (575,24)AATTCATGCCTCAAGTATATGTACAmplicon SizecDNA: 217 bpgenomic: 2,048
Reverse (791,20)GCTGAGGAGATGTGGGTGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.718 kcal/mol
Forward Dimers-0.618 kcal/mol
Reverse Loops1.503 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-2.996 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceAATTCATGCCTCAAGTATATGTACCCACCACCTTCCAGCACAATCCTAGCAAACATTGTA
AATGCCTTGGCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATG
AATTTGCCCACACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATG
CCATTGCATGCACCTCTTCCACCCACATCTCCTCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)217575 - 791
Exon 5 To Exon 7 (Pair 31)
Forward (647,22)AGCGTGCCTAAGTTCTATGTACAmplicon SizecDNA: 227 bpgenomic: 2,058
Reverse (873,23)TCCTCATCATCAGTGCTTTCATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.781 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops2.082 kcal/mol
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.437 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCACA
CCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATGCA
CCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATGAG
GAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)227647 - 873
Exon 5 To Exon 7 (Pair 32)
Forward (569,24)CCTTTAAATTCATGCCTCAAGTATAmplicon SizecDNA: 228 bpgenomic: 2,059
Reverse (796,20)AGGTGGCTGAGGAGATGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.16 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops1.503 kcal/mol
Reverse Dimers-1.715 kcal/mol
Forward-Reverse Dimers-2.996 kcal/mol
Amplicon Folding-1.334 kcal/mol outside primersite
Amplicon SequenceCCTTTAAATTCATGCCTCAAGTATATGTACCCACCACCTTCCAGCACAATCCTAGCAAAC
ATTGTAAATGCCTTGGCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAAT
AAAATGAATTTGCCCACACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGAC
TATATGCCATTGCATGCACCTCTTCCACCCACATCTCCTCAGCCACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)228569 - 796
Exon 5 To Exon 8 (Pair 7)
Forward (647,22)AGCGTGCCTAAGTTCTATGTACAmplicon SizecDNA: 272 bpgenomic: 5,968
Reverse (918,22)GGCTGAAGATTTGCTAGTTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.781 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.092 kcal/mol
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-1.458 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCACA
CCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATGCA
CCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATGAG
GAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATG
AACAAATTAATGGAACTAGCAAATCTTCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)272647 - 918
Exon 5 To Exon 7 (Pair 33)
Forward (645,22)CAAGCGTGCCTAAGTTCTATGTAmplicon SizecDNA: 220 bpgenomic: 2,051
Reverse (864,24)TCAGTGCTTTCATATTCTGATTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.24 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.43 kcal/mol
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-2.356 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCA
CACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATG
CACCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATG
AGGAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)220645 - 864
Exon 5 To Exon 8 (Pair 8)
Forward (645,22)CAAGCGTGCCTAAGTTCTATGTAmplicon SizecDNA: 274 bpgenomic: 5,970
Reverse (918,22)GGCTGAAGATTTGCTAGTTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.24 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.092 kcal/mol
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCA
CACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATG
CACCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATG
AGGAATTATCTAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAA
TGAACAAATTAATGGAACTAGCAAATCTTCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)274645 - 918
Exon 5 To Exon 7 (Pair 34)
Forward (645,22)CAAGCGTGCCTAAGTTCTATGTAmplicon SizecDNA: 217 bpgenomic: 2,048
Reverse (861,24)GTGCTTTCATATTCTGATTCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.24 kcal/mol
Forward Dimers-0.956 kcal/mol
Reverse Loops1.43 kcal/mol
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-2.356 kcal/mol
Amplicon Folding-2.737 kcal/mol outside primersite
Amplicon SequenceCAAGCGTGCCTAAGTTCTATGTACAGGTCCTTCATCTTATGAATAAAATGAATTTGCCCA
CACCTTTTGGACCAATTACTGCGCGACCTCCCATGTATGAAGACTATATGCCATTGCATG
CACCTCTTCCACCCACATCTCCTCAGCCACCTGAGGAACCTCCTTTGCCAGACGAGGATG
AGGAATTATCTAGTGAAGAATCAGAATATGAAAGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)217645 - 861
Exon 7 To Exon 9 (Pair 1)
Forward (847,24)AGAATATGAAAGCACTGATGATGAAmplicon SizecDNA: 263 bpgenomic: 5,948
Reverse (1109,21)CAGCTGGCATGTCGGTAGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.948 kcal/mol in 3' area
Reverse Dimers-2.686 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGC
AAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAA
AATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCT
GTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCA
TATATCTACCGACATGCCAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)263847 - 1109
Exon 7 To Exon 9 (Pair 2)
Forward (836,24)AGTGAAGAATCAGAATATGAAAGCAmplicon SizecDNA: 269 bpgenomic: 5,954
Reverse (1104,22)GGCATGTCGGTAGATATATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.992 kcal/mol in 3' area
Forward Dimers-0.326 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-0.848 kcal/mol
Forward-Reverse Dimers-1.081 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTA
ATGGAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGA
AAAAAGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTA
CATCCAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGA
ATTGAATTCCATATATCTACCGACATGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)269836 - 1104
Exon 7 To Exon 9 (Pair 3)
Forward (836,24)AGTGAAGAATCAGAATATGAAAGCAmplicon SizecDNA: 270 bpgenomic: 5,955
Reverse (1105,22)TGGCATGTCGGTAGATATATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.992 kcal/mol in 3' area
Forward Dimers-0.326 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-1.24 kcal/mol
Forward-Reverse Dimers-1.081 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTA
ATGGAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGA
AAAAAGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTA
CATCCAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGA
ATTGAATTCCATATATCTACCGACATGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)270836 - 1105
Exon 7 To Exon 9 (Pair 4)
Forward (853,22)TGAAAGCACTGATGATGAGGACAmplicon SizecDNA: 245 bpgenomic: 5,930
Reverse (1097,24)CGGTAGATATATGGAATTCAATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-1.624 kcal/mol
Forward-Reverse Dimers-0.877 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAATCT
TCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAATAAA
GGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTTACC
TTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATATATC
TACCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)245853 - 1097
Exon 7 To Exon 9 (Pair 5)
Forward (850,23)ATATGAAAGCACTGATGATGAGGAmplicon SizecDNA: 260 bpgenomic: 5,945
Reverse (1109,21)CAGCTGGCATGTCGGTAGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.948 kcal/mol in 3' area
Reverse Dimers-2.686 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAA
TCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAAT
AAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTT
ACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATAT
ATCTACCGACATGCCAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)260850 - 1109
Exon 7 To Exon 9 (Pair 6)
Forward (850,23)ATATGAAAGCACTGATGATGAGGAmplicon SizecDNA: 257 bpgenomic: 5,942
Reverse (1106,22)CTGGCATGTCGGTAGATATATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-1.396 kcal/mol
Forward-Reverse Dimers-1.415 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAA
TCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAAT
AAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTT
ACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATAT
ATCTACCGACATGCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)257850 - 1106
Exon 7 To Exon 9 (Pair 7)
Forward (853,22)TGAAAGCACTGATGATGAGGACAmplicon SizecDNA: 256 bpgenomic: 5,941
Reverse (1108,22)AGCTGGCATGTCGGTAGATATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-2.112 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAATCT
TCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAATAAA
GGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTTACC
TTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATATATC
TACCGACATGCCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)256853 - 1108
Exon 7 To Exon 9 (Pair 8)
Forward (851,23)TATGAAAGCACTGATGATGAGGAAmplicon SizecDNA: 254 bpgenomic: 5,939
Reverse (1104,22)GGCATGTCGGTAGATATATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-0.848 kcal/mol
Forward-Reverse Dimers-1.415 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAAT
CTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAATA
AAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTTA
CCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATATA
TCTACCGACATGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)254851 - 1104
Exon 7 To Exon 9 (Pair 9)
Forward (845,24)TCAGAATATGAAAGCACTGATGATAmplicon SizecDNA: 264 bpgenomic: 5,949
Reverse (1108,22)AGCTGGCATGTCGGTAGATATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.101 kcal/mol
Forward Dimers-1.558 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-2.112 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTA
GCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGA
AAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTG
CTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTC
CATATATCTACCGACATGCCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)264845 - 1108
Exon 7 To Exon 9 (Pair 10)
Forward (853,22)TGAAAGCACTGATGATGAGGACAmplicon SizecDNA: 255 bpgenomic: 5,940
Reverse (1107,22)GCTGGCATGTCGGTAGATATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAATCT
TCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAATAAA
GGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTTACC
TTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATATATC
TACCGACATGCCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)255853 - 1107
Exon 7 To Exon 9 (Pair 11)
Forward (845,24)TCAGAATATGAAAGCACTGATGATAmplicon SizecDNA: 265 bpgenomic: 5,950
Reverse (1109,21)CAGCTGGCATGTCGGTAGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.101 kcal/mol
Forward Dimers-1.558 kcal/mol
Reverse Loops1.948 kcal/mol in 3' area
Reverse Dimers-2.686 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTA
GCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGA
AAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTG
CTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTC
CATATATCTACCGACATGCCAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)265845 - 1109
Exon 7 To Exon 9 (Pair 12)
Forward (853,22)TGAAAGCACTGATGATGAGGACAmplicon SizecDNA: 254 bpgenomic: 5,939
Reverse (1106,22)CTGGCATGTCGGTAGATATATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-1.396 kcal/mol
Forward-Reverse Dimers-1.415 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAATCT
TCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAATAAA
GGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTTACC
TTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATATATC
TACCGACATGCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)254853 - 1106
Exon 7 To Exon 9 (Pair 13)
Forward (853,22)TGAAAGCACTGATGATGAGGACAmplicon SizecDNA: 252 bpgenomic: 5,937
Reverse (1104,22)GGCATGTCGGTAGATATATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-0.848 kcal/mol
Forward-Reverse Dimers-1.415 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAATCT
TCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAATAAA
GGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTTACC
TTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATATATC
TACCGACATGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)252853 - 1104
Exon 7 To Exon 9 (Pair 14)
Forward (851,23)TATGAAAGCACTGATGATGAGGAAmplicon SizecDNA: 256 bpgenomic: 5,941
Reverse (1106,22)CTGGCATGTCGGTAGATATATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-1.396 kcal/mol
Forward-Reverse Dimers-1.415 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAAT
CTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAATA
AAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTTA
CCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATATA
TCTACCGACATGCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)256851 - 1106
Exon 7 To Exon 9 (Pair 15)
Forward (847,24)AGAATATGAAAGCACTGATGATGAAmplicon SizecDNA: 261 bpgenomic: 5,946
Reverse (1107,22)GCTGGCATGTCGGTAGATATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGC
AAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAA
AATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCT
GTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCA
TATATCTACCGACATGCCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)261847 - 1107
Exon 7 To Exon 9 (Pair 16)
Forward (853,22)TGAAAGCACTGATGATGAGGACAmplicon SizecDNA: 253 bpgenomic: 5,938
Reverse (1105,22)TGGCATGTCGGTAGATATATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-1.24 kcal/mol
Forward-Reverse Dimers-1.415 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAATCT
TCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAATAAA
GGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTTACC
TTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATATATC
TACCGACATGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)253853 - 1105
Exon 7 To Exon 9 (Pair 17)
Forward (847,24)AGAATATGAAAGCACTGATGATGAAmplicon SizecDNA: 251 bpgenomic: 5,936
Reverse (1097,24)CGGTAGATATATGGAATTCAATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-1.624 kcal/mol
Forward-Reverse Dimers-1.308 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGC
AAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAA
AATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCT
GTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCA
TATATCTACCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)251847 - 1097
Exon 7 To Exon 9 (Pair 18)
Forward (850,23)ATATGAAAGCACTGATGATGAGGAmplicon SizecDNA: 254 bpgenomic: 5,939
Reverse (1103,23)GCATGTCGGTAGATATATGGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-0.784 kcal/mol
Forward-Reverse Dimers-1.415 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAA
TCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAAT
AAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTT
ACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATAT
ATCTACCGACATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)254850 - 1103
Exon 7 To Exon 9 (Pair 19)
Forward (850,23)ATATGAAAGCACTGATGATGAGGAmplicon SizecDNA: 256 bpgenomic: 5,941
Reverse (1105,22)TGGCATGTCGGTAGATATATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-1.24 kcal/mol
Forward-Reverse Dimers-1.415 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAA
TCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAAT
AAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTT
ACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATAT
ATCTACCGACATGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)256850 - 1105
Exon 7 To Exon 9 (Pair 20)
Forward (851,23)TATGAAAGCACTGATGATGAGGAAmplicon SizecDNA: 253 bpgenomic: 5,938
Reverse (1103,23)GCATGTCGGTAGATATATGGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-0.784 kcal/mol
Forward-Reverse Dimers-1.415 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAAT
CTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAATA
AAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTTA
CCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATATA
TCTACCGACATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)253851 - 1103
Exon 7 To Exon 9 (Pair 21)
Forward (850,23)ATATGAAAGCACTGATGATGAGGAmplicon SizecDNA: 259 bpgenomic: 5,944
Reverse (1108,22)AGCTGGCATGTCGGTAGATATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-2.112 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAA
TCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAAT
AAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTT
ACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATAT
ATCTACCGACATGCCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)259850 - 1108
Exon 7 To Exon 9 (Pair 22)
Forward (851,23)TATGAAAGCACTGATGATGAGGAAmplicon SizecDNA: 259 bpgenomic: 5,944
Reverse (1109,21)CAGCTGGCATGTCGGTAGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.948 kcal/mol in 3' area
Reverse Dimers-2.686 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAAT
CTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAATA
AAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTTA
CCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATATA
TCTACCGACATGCCAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)259851 - 1109
Exon 7 To Exon 9 (Pair 23)
Forward (850,23)ATATGAAAGCACTGATGATGAGGAmplicon SizecDNA: 258 bpgenomic: 5,943
Reverse (1107,22)GCTGGCATGTCGGTAGATATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAA
TCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAAT
AAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTT
ACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATAT
ATCTACCGACATGCCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)258850 - 1107
Exon 7 To Exon 9 (Pair 24)
Forward (851,23)TATGAAAGCACTGATGATGAGGAAmplicon SizecDNA: 255 bpgenomic: 5,940
Reverse (1105,22)TGGCATGTCGGTAGATATATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-1.24 kcal/mol
Forward-Reverse Dimers-1.415 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAAT
CTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAATA
AAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTTA
CCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATATA
TCTACCGACATGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)255851 - 1105
Exon 7 To Exon 9 (Pair 25)
Forward (836,24)AGTGAAGAATCAGAATATGAAAGCAmplicon SizecDNA: 268 bpgenomic: 5,953
Reverse (1103,23)GCATGTCGGTAGATATATGGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.992 kcal/mol in 3' area
Forward Dimers-0.326 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-0.784 kcal/mol
Forward-Reverse Dimers-1.081 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTA
ATGGAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGA
AAAAAGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTA
CATCCAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGA
ATTGAATTCCATATATCTACCGACATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)268836 - 1103
Exon 7 To Exon 9 (Pair 26)
Forward (853,22)TGAAAGCACTGATGATGAGGACAmplicon SizecDNA: 251 bpgenomic: 5,936
Reverse (1103,23)GCATGTCGGTAGATATATGGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-0.784 kcal/mol
Forward-Reverse Dimers-1.415 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAATCT
TCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAATAAA
GGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTTACC
TTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATATATC
TACCGACATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)251853 - 1103
Exon 7 To Exon 9 (Pair 27)
Forward (853,22)TGAAAGCACTGATGATGAGGACAmplicon SizecDNA: 257 bpgenomic: 5,942
Reverse (1109,21)CAGCTGGCATGTCGGTAGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.948 kcal/mol in 3' area
Reverse Dimers-2.686 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAATCT
TCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAATAAA
GGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTTACC
TTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATATATC
TACCGACATGCCAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)257853 - 1109
Exon 7 To Exon 9 (Pair 28)
Forward (836,24)AGTGAAGAATCAGAATATGAAAGCAmplicon SizecDNA: 262 bpgenomic: 5,947
Reverse (1097,24)CGGTAGATATATGGAATTCAATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.992 kcal/mol in 3' area
Forward Dimers-0.326 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-1.624 kcal/mol
Forward-Reverse Dimers-1.375 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTA
ATGGAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGA
AAAAAGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTA
CATCCAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGA
ATTGAATTCCATATATCTACCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)262836 - 1097
Exon 7 To Exon 9 (Pair 29)
Forward (845,24)TCAGAATATGAAAGCACTGATGATAmplicon SizecDNA: 253 bpgenomic: 5,938
Reverse (1097,24)CGGTAGATATATGGAATTCAATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.101 kcal/mol
Forward Dimers-1.558 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-1.624 kcal/mol
Forward-Reverse Dimers-1.308 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTA
GCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGA
AAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTG
CTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTC
CATATATCTACCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)253845 - 1097
Exon 7 To Exon 9 (Pair 30)
Forward (850,23)ATATGAAAGCACTGATGATGAGGAmplicon SizecDNA: 255 bpgenomic: 5,940
Reverse (1104,22)GGCATGTCGGTAGATATATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-0.848 kcal/mol
Forward-Reverse Dimers-1.415 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAA
TCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAAT
AAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTT
ACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATAT
ATCTACCGACATGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)255850 - 1104
Exon 7 To Exon 9 (Pair 31)
Forward (847,24)AGAATATGAAAGCACTGATGATGAAmplicon SizecDNA: 262 bpgenomic: 5,947
Reverse (1108,22)AGCTGGCATGTCGGTAGATATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-2.112 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGC
AAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAA
AATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCT
GTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCA
TATATCTACCGACATGCCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)262847 - 1108
Exon 7 To Exon 9 (Pair 32)
Forward (851,23)TATGAAAGCACTGATGATGAGGAAmplicon SizecDNA: 258 bpgenomic: 5,943
Reverse (1108,22)AGCTGGCATGTCGGTAGATATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-2.112 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAAT
CTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAATA
AAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTTA
CCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATATA
TCTACCGACATGCCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)258851 - 1108
Exon 7 To Exon 9 (Pair 33)
Forward (836,24)AGTGAAGAATCAGAATATGAAAGCAmplicon SizecDNA: 271 bpgenomic: 5,956
Reverse (1106,22)CTGGCATGTCGGTAGATATATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.992 kcal/mol in 3' area
Forward Dimers-0.326 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-1.396 kcal/mol
Forward-Reverse Dimers-1.081 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAGTGAAGAATCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTA
ATGGAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGA
AAAAAGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTA
CATCCAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGA
ATTGAATTCCATATATCTACCGACATGCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)271836 - 1106
Exon 7 To Exon 9 (Pair 34)
Forward (845,24)TCAGAATATGAAAGCACTGATGATAmplicon SizecDNA: 263 bpgenomic: 5,948
Reverse (1107,22)GCTGGCATGTCGGTAGATATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.101 kcal/mol
Forward Dimers-1.558 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTCAGAATATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTA
GCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGA
AAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTG
CTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTC
CATATATCTACCGACATGCCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)263845 - 1107
Exon 7 To Exon 9 (Pair 35)
Forward (851,23)TATGAAAGCACTGATGATGAGGAAmplicon SizecDNA: 257 bpgenomic: 5,942
Reverse (1107,22)GCTGGCATGTCGGTAGATATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTATGAAAGCACTGATGATGAGGACCGACAGAGAATGAACAAATTAATGGAACTAGCAAAT
CTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAAAGAGAAAAATA
AAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATCCAGTGCTGTTA
CCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCATATA
TCTACCGACATGCCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)257851 - 1107
Exon 8 To Exon 9 (Pair 1)
Forward (900,23)AACTAGCAAATCTTCAGCCCAAAAmplicon SizecDNA: 209 bpgenomic: 2,029
Reverse (1108,22)AGCTGGCATGTCGGTAGATATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-2.112 kcal/mol
Forward-Reverse Dimers-2.111 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAA
AGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATC
CAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTG
AATTCCATATATCTACCGACATGCCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)209900 - 1108
Exon 8 To Exon 9 (Pair 2)
Forward (900,23)AACTAGCAAATCTTCAGCCCAAAAmplicon SizecDNA: 210 bpgenomic: 2,030
Reverse (1109,21)CAGCTGGCATGTCGGTAGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.948 kcal/mol in 3' area
Reverse Dimers-2.686 kcal/mol
Forward-Reverse Dimers-2.111 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAA
AGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATC
CAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTG
AATTCCATATATCTACCGACATGCCAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)210900 - 1109
Exon 8 To Exon 9 (Pair 3)
Forward (893,24)TTAATGGAACTAGCAAATCTTCAGAmplicon SizecDNA: 216 bpgenomic: 2,036
Reverse (1108,22)AGCTGGCATGTCGGTAGATATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-2.112 kcal/mol
Forward-Reverse Dimers-1.783 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTTAATGGAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTG
AGAAAAAAGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGT
TTACATCCAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAA
AGAATTGAATTCCATATATCTACCGACATGCCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)216893 - 1108
Exon 8 To Exon 9 (Pair 4)
Forward (897,22)TGGAACTAGCAAATCTTCAGCCAmplicon SizecDNA: 208 bpgenomic: 2,028
Reverse (1104,22)GGCATGTCGGTAGATATATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-0.848 kcal/mol
Forward-Reverse Dimers-1.712 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTGGAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAA
AAAAGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTAC
ATCCAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAA
TTGAATTCCATATATCTACCGACATGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)208897 - 1104
Exon 8 To Exon 9 (Pair 5)
Forward (895,23)AATGGAACTAGCAAATCTTCAGCAmplicon SizecDNA: 211 bpgenomic: 2,031
Reverse (1105,22)TGGCATGTCGGTAGATATATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-1.24 kcal/mol
Forward-Reverse Dimers-1.712 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAATGGAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAG
AAAAAAGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTT
ACATCCAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAG
AATTGAATTCCATATATCTACCGACATGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)211895 - 1105
Exon 8 To Exon 9 (Pair 6)
Forward (895,23)AATGGAACTAGCAAATCTTCAGCAmplicon SizecDNA: 210 bpgenomic: 2,030
Reverse (1104,22)GGCATGTCGGTAGATATATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-0.848 kcal/mol
Forward-Reverse Dimers-1.712 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAATGGAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAG
AAAAAAGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTT
ACATCCAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAG
AATTGAATTCCATATATCTACCGACATGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)210895 - 1104
Exon 8 To Exon 9 (Pair 7)
Forward (899,22)GAACTAGCAAATCTTCAGCCCAAmplicon SizecDNA: 205 bpgenomic: 2,025
Reverse (1103,23)GCATGTCGGTAGATATATGGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-0.784 kcal/mol
Forward-Reverse Dimers-1.712 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceGAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAA
AAGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACAT
CCAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATT
GAATTCCATATATCTACCGACATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)205899 - 1103
Exon 8 To Exon 9 (Pair 8)
Forward (900,23)AACTAGCAAATCTTCAGCCCAAAAmplicon SizecDNA: 204 bpgenomic: 2,024
Reverse (1103,23)GCATGTCGGTAGATATATGGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-0.784 kcal/mol
Forward-Reverse Dimers-1.712 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAAAAA
AGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTACATC
CAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTG
AATTCCATATATCTACCGACATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)204900 - 1103
Exon 8 To Exon 9 (Pair 9)
Forward (895,23)AATGGAACTAGCAAATCTTCAGCAmplicon SizecDNA: 203 bpgenomic: 2,023
Reverse (1097,24)CGGTAGATATATGGAATTCAATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-1.624 kcal/mol
Forward-Reverse Dimers-1.712 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAATGGAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAG
AAAAAAGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTT
ACATCCAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAG
AATTGAATTCCATATATCTACCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)203895 - 1097
Exon 8 To Exon 9 (Pair 10)
Forward (897,22)TGGAACTAGCAAATCTTCAGCCAmplicon SizecDNA: 207 bpgenomic: 2,027
Reverse (1103,23)GCATGTCGGTAGATATATGGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-0.784 kcal/mol
Forward-Reverse Dimers-1.712 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTGGAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAGAA
AAAAGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTTAC
ATCCAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAA
TTGAATTCCATATATCTACCGACATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)207897 - 1103
Exon 8 To Exon 9 (Pair 11)
Forward (893,24)TTAATGGAACTAGCAAATCTTCAGAmplicon SizecDNA: 217 bpgenomic: 2,037
Reverse (1109,21)CAGCTGGCATGTCGGTAGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.948 kcal/mol in 3' area
Reverse Dimers-2.686 kcal/mol
Forward-Reverse Dimers-1.783 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceTTAATGGAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTG
AGAAAAAAGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGT
TTACATCCAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAA
AGAATTGAATTCCATATATCTACCGACATGCCAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)217893 - 1109
Exon 8 To Exon 9 (Pair 12)
Forward (895,23)AATGGAACTAGCAAATCTTCAGCAmplicon SizecDNA: 209 bpgenomic: 2,029
Reverse (1103,23)GCATGTCGGTAGATATATGGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-0.784 kcal/mol
Forward-Reverse Dimers-1.712 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAATGGAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAG
AAAAAAGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTT
ACATCCAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAG
AATTGAATTCCATATATCTACCGACATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)209895 - 1103
Exon 8 To Exon 9 (Pair 13)
Forward (895,23)AATGGAACTAGCAAATCTTCAGCAmplicon SizecDNA: 212 bpgenomic: 2,032
Reverse (1106,22)CTGGCATGTCGGTAGATATATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.035 kcal/mol in 3' area
Reverse Dimers-1.396 kcal/mol
Forward-Reverse Dimers-1.712 kcal/mol
Amplicon Folding-2.115 kcal/mol outside primersite
Amplicon SequenceAATGGAACTAGCAAATCTTCAGCCCAAAAGACCTAAAACAATAAAGCAGCGCCATGTGAG
AAAAAAGAGAAAAATAAAGGATATGTTGAATACACCTTTGTGTCCTTCACACAGCAGTTT
ACATCCAGTGCTGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAG
AATTGAATTCCATATATCTACCGACATGCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)212895 - 1106
Exon 9 To Exon 10 (Pair 1)
Forward (1076,24)ATTGAATTCCATATATCTACCGACAmplicon SizecDNA: 223 bpgenomic: 1,716
Reverse (1298,24)CCAATTCCCTTCTAGAAATACATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.933 kcal/mol
Forward Dimers-1.07 kcal/mol
Reverse Loops1.435 kcal/mol
Reverse Dimers-1.742 kcal/mol
Forward-Reverse Dimers-1.44 kcal/mol
Amplicon Folding-2.711 kcal/mol outside primersite
Amplicon SequenceATTGAATTCCATATATCTACCGACATGCCAGCTGCATTTAAGAAAGATTTAGAAAAGGAA
CAAAATTGTGAGGAAAAAAATCATGATTTACCTGCTACTGAAGTTGATGCATCCAATATA
GGATTTGGAAAAATCTTCCCCAAACCTAATTTGGACATCACAGAGGAGATTAAAGAAGAC
TCTGATGAAATGCCTTCAGAATGTATTTCTAGAAGGGAATTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)2231076 - 1298
Exon 9 To Exon 10 (Pair 2)
Forward (1076,24)ATTGAATTCCATATATCTACCGACAmplicon SizecDNA: 247 bpgenomic: 1,740
Reverse (1322,23)CTTCTCTAGAAATTCTGCCCTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.933 kcal/mol
Forward Dimers-1.07 kcal/mol
Reverse Loops1.417 kcal/mol
Reverse Dimers-1.582 kcal/mol
Forward-Reverse Dimers-1.507 kcal/mol
Amplicon Folding-2.711 kcal/mol outside primersite
Amplicon SequenceATTGAATTCCATATATCTACCGACATGCCAGCTGCATTTAAGAAAGATTTAGAAAAGGAA
CAAAATTGTGAGGAAAAAAATCATGATTTACCTGCTACTGAAGTTGATGCATCCAATATA
GGATTTGGAAAAATCTTCCCCAAACCTAATTTGGACATCACAGAGGAGATTAAAGAAGAC
TCTGATGAAATGCCTTCAGAATGTATTTCTAGAAGGGAATTGGAAAAGGGCAGAATTTCT
AGAGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)2471076 - 1322
Exon 9 To Exon 10 (Pair 3)
Forward (1076,24)ATTGAATTCCATATATCTACCGACAmplicon SizecDNA: 222 bpgenomic: 1,715
Reverse (1297,24)CAATTCCCTTCTAGAAATACATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.933 kcal/mol
Forward Dimers-1.07 kcal/mol
Reverse Loops1.404 kcal/mol in 3' area
Reverse Dimers-1.742 kcal/mol
Forward-Reverse Dimers-1.44 kcal/mol
Amplicon Folding-2.711 kcal/mol outside primersite
Amplicon SequenceATTGAATTCCATATATCTACCGACATGCCAGCTGCATTTAAGAAAGATTTAGAAAAGGAA
CAAAATTGTGAGGAAAAAAATCATGATTTACCTGCTACTGAAGTTGATGCATCCAATATA
GGATTTGGAAAAATCTTCCCCAAACCTAATTTGGACATCACAGAGGAGATTAAAGAAGAC
TCTGATGAAATGCCTTCAGAATGTATTTCTAGAAGGGAATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)2221076 - 1297
Exon 9 To Exon 10 (Pair 4)
Forward (1027,23)GTTACCTTCAGATGTATTTGACCAmplicon SizecDNA: 232 bpgenomic: 1,725
Reverse (1258,23)AGAGTCTTCTTTAATCTCCTCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.916 kcal/mol in 3' area
Forward Dimers-0.314 kcal/mol
Reverse Loops1.315 kcal/mol
Reverse Dimers-1.38 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-2.565 kcal/mol outside primersite
Amplicon SequenceGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCA
TATATCTACCGACATGCCAGCTGCATTTAAGAAAGATTTAGAAAAGGAACAAAATTGTGA
GGAAAAAAATCATGATTTACCTGCTACTGAAGTTGATGCATCCAATATAGGATTTGGAAA
AATCTTCCCCAAACCTAATTTGGACATCACAGAGGAGATTAAAGAAGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)2321027 - 1258
Exon 9 To Exon 10 (Pair 5)
Forward (1074,24)GAATTGAATTCCATATATCTACCGAmplicon SizecDNA: 225 bpgenomic: 1,718
Reverse (1298,24)CCAATTCCCTTCTAGAAATACATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.452 kcal/mol
Forward Dimers-1.512 kcal/mol
Reverse Loops1.435 kcal/mol
Reverse Dimers-1.742 kcal/mol
Forward-Reverse Dimers-2.254 kcal/mol
Amplicon Folding-2.711 kcal/mol outside primersite
Amplicon SequenceGAATTGAATTCCATATATCTACCGACATGCCAGCTGCATTTAAGAAAGATTTAGAAAAGG
AACAAAATTGTGAGGAAAAAAATCATGATTTACCTGCTACTGAAGTTGATGCATCCAATA
TAGGATTTGGAAAAATCTTCCCCAAACCTAATTTGGACATCACAGAGGAGATTAAAGAAG
ACTCTGATGAAATGCCTTCAGAATGTATTTCTAGAAGGGAATTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)2251074 - 1298
Exon 9 To Exon 10 (Pair 6)
Forward (1074,24)GAATTGAATTCCATATATCTACCGAmplicon SizecDNA: 227 bpgenomic: 1,720
Reverse (1300,24)TTCCAATTCCCTTCTAGAAATACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.452 kcal/mol
Forward Dimers-1.512 kcal/mol
Reverse Loops1.435 kcal/mol in 3' area
Reverse Dimers-1.742 kcal/mol
Forward-Reverse Dimers-2.254 kcal/mol
Amplicon Folding-2.711 kcal/mol outside primersite
Amplicon SequenceGAATTGAATTCCATATATCTACCGACATGCCAGCTGCATTTAAGAAAGATTTAGAAAAGG
AACAAAATTGTGAGGAAAAAAATCATGATTTACCTGCTACTGAAGTTGATGCATCCAATA
TAGGATTTGGAAAAATCTTCCCCAAACCTAATTTGGACATCACAGAGGAGATTAAAGAAG
ACTCTGATGAAATGCCTTCAGAATGTATTTCTAGAAGGGAATTGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)2271074 - 1300
Exon 9 To Exon 10 (Pair 7)
Forward (1027,23)GTTACCTTCAGATGTATTTGACCAmplicon SizecDNA: 229 bpgenomic: 1,722
Reverse (1255,23)GTCTTCTTTAATCTCCTCTGTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.916 kcal/mol in 3' area
Forward Dimers-0.314 kcal/mol
Reverse Loops2.607 kcal/mol in 3' area
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-2.565 kcal/mol outside primersite
Amplicon SequenceGTTACCTTCAGATGTATTTGACCAACCACAACCTGTAGGTAACAAAAGAATTGAATTCCA
TATATCTACCGACATGCCAGCTGCATTTAAGAAAGATTTAGAAAAGGAACAAAATTGTGA
GGAAAAAAATCATGATTTACCTGCTACTGAAGTTGATGCATCCAATATAGGATTTGGAAA
AATCTTCCCCAAACCTAATTTGGACATCACAGAGGAGATTAAAGAAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)2291027 - 1255
Exon 9 To Exon 10 (Pair 8)
Forward (1076,24)ATTGAATTCCATATATCTACCGACAmplicon SizecDNA: 224 bpgenomic: 1,717
Reverse (1299,24)TCCAATTCCCTTCTAGAAATACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.933 kcal/mol
Forward Dimers-1.07 kcal/mol
Reverse Loops1.435 kcal/mol in 3' area
Reverse Dimers-1.742 kcal/mol
Forward-Reverse Dimers-1.44 kcal/mol
Amplicon Folding-2.711 kcal/mol outside primersite
Amplicon SequenceATTGAATTCCATATATCTACCGACATGCCAGCTGCATTTAAGAAAGATTTAGAAAAGGAA
CAAAATTGTGAGGAAAAAAATCATGATTTACCTGCTACTGAAGTTGATGCATCCAATATA
GGATTTGGAAAAATCTTCCCCAAACCTAATTTGGACATCACAGAGGAGATTAAAGAAGAC
TCTGATGAAATGCCTTCAGAATGTATTTCTAGAAGGGAATTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)2241076 - 1299
Exon 9 To Exon 10 (Pair 9)
Forward (1074,24)GAATTGAATTCCATATATCTACCGAmplicon SizecDNA: 220 bpgenomic: 1,713
Reverse (1293,24)TCCCTTCTAGAAATACATTCTGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.452 kcal/mol
Forward Dimers-1.512 kcal/mol
Reverse Loops0.351 kcal/mol in 3' area
Reverse Dimers-1.742 kcal/mol
Forward-Reverse Dimers-0.991 kcal/mol
Amplicon Folding-2.711 kcal/mol outside primersite
Amplicon SequenceGAATTGAATTCCATATATCTACCGACATGCCAGCTGCATTTAAGAAAGATTTAGAAAAGG
AACAAAATTGTGAGGAAAAAAATCATGATTTACCTGCTACTGAAGTTGATGCATCCAATA
TAGGATTTGGAAAAATCTTCCCCAAACCTAATTTGGACATCACAGAGGAGATTAAAGAAG
ACTCTGATGAAATGCCTTCAGAATGTATTTCTAGAAGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017619 (RNPC3)2201074 - 1293
 

See below for some more details.

Program Output:

Loading ...