Design Results for runx1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size500
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 4 (Pair 3)
Forward (1560,22)GGTTGTCAAGAGGATTTGAGACAmplicon SizecDNA: 212 bpgenomic: 145,184
Reverse (1771,23)GTCTCTAGAAGGATTCATTCCAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.459 kcal/mol in 3' area
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-1.736 kcal/mol
Amplicon Folding-2.948 kcal/mol outside primersite
Amplicon SequenceGGTTGTCAAGAGGATTTGAGACAATATGTATAAAGCAATGGACACGCAGAGGAAGTCAAT
AAGTACAAGGTAACTCTGAAAATGCCACCAAAGGGAGGCTAGGGACAGGAAAGCCATCTC
CGCCAACCTCAAGAACGTGGCCCCGAAGCTGTTCCAGGAACTGGGCATGTATGAAGATAA
AATGCATACTTGGAATGAATCCTTCTAGAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 4)
Forward (1560,22)GGTTGTCAAGAGGATTTGAGACAmplicon SizecDNA: 206 bpgenomic: 145,178
Reverse (1765,23)AGAAGGATTCATTCCAAGTATGCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.459 kcal/mol
Reverse Dimers-0.655 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-2.948 kcal/mol outside primersite
Amplicon SequenceGGTTGTCAAGAGGATTTGAGACAATATGTATAAAGCAATGGACACGCAGAGGAAGTCAAT
AAGTACAAGGTAACTCTGAAAATGCCACCAAAGGGAGGCTAGGGACAGGAAAGCCATCTC
CGCCAACCTCAAGAACGTGGCCCCGAAGCTGTTCCAGGAACTGGGCATGTATGAAGATAA
AATGCATACTTGGAATGAATCCTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 6)
Forward (1558,23)ATGGTTGTCAAGAGGATTTGAGAAmplicon SizecDNA: 215 bpgenomic: 145,187
Reverse (1772,22)CGTCTCTAGAAGGATTCATTCCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.712 kcal/mol
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-1.736 kcal/mol
Amplicon Folding-2.948 kcal/mol outside primersite
Amplicon SequenceATGGTTGTCAAGAGGATTTGAGACAATATGTATAAAGCAATGGACACGCAGAGGAAGTCA
ATAAGTACAAGGTAACTCTGAAAATGCCACCAAAGGGAGGCTAGGGACAGGAAAGCCATC
TCCGCCAACCTCAAGAACGTGGCCCCGAAGCTGTTCCAGGAACTGGGCATGTATGAAGAT
AAAATGCATACTTGGAATGAATCCTTCTAGAGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 8)
Forward (1558,23)ATGGTTGTCAAGAGGATTTGAGAAmplicon SizecDNA: 212 bpgenomic: 145,184
Reverse (1769,23)CTCTAGAAGGATTCATTCCAAGTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.459 kcal/mol in 3' area
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-1.416 kcal/mol
Amplicon Folding-2.948 kcal/mol outside primersite
Amplicon SequenceATGGTTGTCAAGAGGATTTGAGACAATATGTATAAAGCAATGGACACGCAGAGGAAGTCA
ATAAGTACAAGGTAACTCTGAAAATGCCACCAAAGGGAGGCTAGGGACAGGAAAGCCATC
TCCGCCAACCTCAAGAACGTGGCCCCGAAGCTGTTCCAGGAACTGGGCATGTATGAAGAT
AAAATGCATACTTGGAATGAATCCTTCTAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 10)
Forward (1558,23)ATGGTTGTCAAGAGGATTTGAGAAmplicon SizecDNA: 208 bpgenomic: 145,180
Reverse (1765,23)AGAAGGATTCATTCCAAGTATGCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.459 kcal/mol
Reverse Dimers-0.655 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-2.948 kcal/mol outside primersite
Amplicon SequenceATGGTTGTCAAGAGGATTTGAGACAATATGTATAAAGCAATGGACACGCAGAGGAAGTCA
ATAAGTACAAGGTAACTCTGAAAATGCCACCAAAGGGAGGCTAGGGACAGGAAAGCCATC
TCCGCCAACCTCAAGAACGTGGCCCCGAAGCTGTTCCAGGAACTGGGCATGTATGAAGAT
AAAATGCATACTTGGAATGAATCCTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 11)
Forward (1558,23)ATGGTTGTCAAGAGGATTTGAGAAmplicon SizecDNA: 213 bpgenomic: 145,185
Reverse (1770,23)TCTCTAGAAGGATTCATTCCAAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.459 kcal/mol in 3' area
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-1.721 kcal/mol
Amplicon Folding-2.948 kcal/mol outside primersite
Amplicon SequenceATGGTTGTCAAGAGGATTTGAGACAATATGTATAAAGCAATGGACACGCAGAGGAAGTCA
ATAAGTACAAGGTAACTCTGAAAATGCCACCAAAGGGAGGCTAGGGACAGGAAAGCCATC
TCCGCCAACCTCAAGAACGTGGCCCCGAAGCTGTTCCAGGAACTGGGCATGTATGAAGAT
AAAATGCATACTTGGAATGAATCCTTCTAGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 12)
Forward (1560,22)GGTTGTCAAGAGGATTTGAGACAmplicon SizecDNA: 211 bpgenomic: 145,183
Reverse (1770,23)TCTCTAGAAGGATTCATTCCAAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.459 kcal/mol in 3' area
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-1.721 kcal/mol
Amplicon Folding-2.948 kcal/mol outside primersite
Amplicon SequenceGGTTGTCAAGAGGATTTGAGACAATATGTATAAAGCAATGGACACGCAGAGGAAGTCAAT
AAGTACAAGGTAACTCTGAAAATGCCACCAAAGGGAGGCTAGGGACAGGAAAGCCATCTC
CGCCAACCTCAAGAACGTGGCCCCGAAGCTGTTCCAGGAACTGGGCATGTATGAAGATAA
AATGCATACTTGGAATGAATCCTTCTAGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 13)
Forward (1558,23)ATGGTTGTCAAGAGGATTTGAGAAmplicon SizecDNA: 214 bpgenomic: 145,186
Reverse (1771,23)GTCTCTAGAAGGATTCATTCCAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.459 kcal/mol in 3' area
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-1.736 kcal/mol
Amplicon Folding-2.948 kcal/mol outside primersite
Amplicon SequenceATGGTTGTCAAGAGGATTTGAGACAATATGTATAAAGCAATGGACACGCAGAGGAAGTCA
ATAAGTACAAGGTAACTCTGAAAATGCCACCAAAGGGAGGCTAGGGACAGGAAAGCCATC
TCCGCCAACCTCAAGAACGTGGCCCCGAAGCTGTTCCAGGAACTGGGCATGTATGAAGAT
AAAATGCATACTTGGAATGAATCCTTCTAGAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 14)
Forward (1560,22)GGTTGTCAAGAGGATTTGAGACAmplicon SizecDNA: 210 bpgenomic: 145,182
Reverse (1769,23)CTCTAGAAGGATTCATTCCAAGTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.459 kcal/mol in 3' area
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-1.416 kcal/mol
Amplicon Folding-2.948 kcal/mol outside primersite
Amplicon SequenceGGTTGTCAAGAGGATTTGAGACAATATGTATAAAGCAATGGACACGCAGAGGAAGTCAAT
AAGTACAAGGTAACTCTGAAAATGCCACCAAAGGGAGGCTAGGGACAGGAAAGCCATCTC
CGCCAACCTCAAGAACGTGGCCCCGAAGCTGTTCCAGGAACTGGGCATGTATGAAGATAA
AATGCATACTTGGAATGAATCCTTCTAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 16)
Forward (1560,22)GGTTGTCAAGAGGATTTGAGACAmplicon SizecDNA: 213 bpgenomic: 145,185
Reverse (1772,22)CGTCTCTAGAAGGATTCATTCCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.712 kcal/mol
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-1.736 kcal/mol
Amplicon Folding-2.948 kcal/mol outside primersite
Amplicon SequenceGGTTGTCAAGAGGATTTGAGACAATATGTATAAAGCAATGGACACGCAGAGGAAGTCAAT
AAGTACAAGGTAACTCTGAAAATGCCACCAAAGGGAGGCTAGGGACAGGAAAGCCATCTC
CGCCAACCTCAAGAACGTGGCCCCGAAGCTGTTCCAGGAACTGGGCATGTATGAAGATAA
AATGCATACTTGGAATGAATCCTTCTAGAGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 17)
Forward (1558,23)ATGGTTGTCAAGAGGATTTGAGAAmplicon SizecDNA: 211 bpgenomic: 145,183
Reverse (1768,24)TCTAGAAGGATTCATTCCAAGTATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.459 kcal/mol
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-2.948 kcal/mol outside primersite
Amplicon SequenceATGGTTGTCAAGAGGATTTGAGACAATATGTATAAAGCAATGGACACGCAGAGGAAGTCA
ATAAGTACAAGGTAACTCTGAAAATGCCACCAAAGGGAGGCTAGGGACAGGAAAGCCATC
TCCGCCAACCTCAAGAACGTGGCCCCGAAGCTGTTCCAGGAACTGGGCATGTATGAAGAT
AAAATGCATACTTGGAATGAATCCTTCTAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 18)
Forward (1560,22)GGTTGTCAAGAGGATTTGAGACAmplicon SizecDNA: 209 bpgenomic: 145,181
Reverse (1768,24)TCTAGAAGGATTCATTCCAAGTATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.459 kcal/mol
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-2.948 kcal/mol outside primersite
Amplicon SequenceGGTTGTCAAGAGGATTTGAGACAATATGTATAAAGCAATGGACACGCAGAGGAAGTCAAT
AAGTACAAGGTAACTCTGAAAATGCCACCAAAGGGAGGCTAGGGACAGGAAAGCCATCTC
CGCCAACCTCAAGAACGTGGCCCCGAAGCTGTTCCAGGAACTGGGCATGTATGAAGATAA
AATGCATACTTGGAATGAATCCTTCTAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 1)
Forward (3558,20)CCCAACTTCCTCTGCTCCGTAmplicon SizecDNA: 115 bpgenomic: 6,244
Reverse (3672,21)TCACAGTGACCAGAGTGCCATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.32 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.129 kcal/mol
Reverse Dimers-2.076 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-0.98 kcal/mol outside primersite
Amplicon SequenceCCCAACTTCCTCTGCTCCGTGCTGCCTACGCACTGGCGCTGCAACAAGACCCTGCCCATC
GCTTTCAAGGTGGTGGCCCTAGGGGATGTTCCAGATGGCACTCTGGTCACTGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001754 (RUNX1)115473 - 587
NM_001122607 (RUNX1)1151780 - 1894
NM_001001890 (RUNX1)1151780 - 1894
Exon 5 To Exon 6 (Pair 2)
Forward (3558,20)CCCAACTTCCTCTGCTCCGTAmplicon SizecDNA: 113 bpgenomic: 6,242
Reverse (3670,21)ACAGTGACCAGAGTGCCATCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.32 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.129 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-0.98 kcal/mol outside primersite
Amplicon SequenceCCCAACTTCCTCTGCTCCGTGCTGCCTACGCACTGGCGCTGCAACAAGACCCTGCCCATC
GCTTTCAAGGTGGTGGCCCTAGGGGATGTTCCAGATGGCACTCTGGTCACTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1131780 - 1892
NM_001754 (RUNX1)113473 - 585
NM_001122607 (RUNX1)1131780 - 1892
Exon 6 To Exon 7 (Pair 1)
Forward (3650,21)AGATGGCACTCTGGTCACTGTAmplicon SizecDNA: 181 bpgenomic: 21,159
Reverse (3830,21)TTGCGGTGGGTTTGTGAAGACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.258 kcal/mol
Forward Dimers-1.447 kcal/mol
Reverse Loops1.976 kcal/mol in 3' area
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-1.281 kcal/mol
Amplicon Folding-2.396 kcal/mol outside primersite
Amplicon SequenceAGATGGCACTCTGGTCACTGTGATGGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAG
AAATGCTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGG
TCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCA
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1811872 - 2052
NM_001754 (RUNX1)181565 - 745
NM_001122607 (RUNX1)1811872 - 2052
Exon 6 To Exon 7 (Pair 2)
Forward (3650,21)AGATGGCACTCTGGTCACTGTAmplicon SizecDNA: 194 bpgenomic: 21,172
Reverse (3843,19)GGTAGGTGGCGACTTGCGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.258 kcal/mol
Forward Dimers-1.447 kcal/mol
Reverse Loops0.759 kcal/mol in 3' area
Reverse Dimers-1.675 kcal/mol
Forward-Reverse Dimers-2.014 kcal/mol
Amplicon Folding-2.396 kcal/mol outside primersite
Amplicon SequenceAGATGGCACTCTGGTCACTGTGATGGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAG
AAATGCTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGG
TCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCA
AGTCGCCACCTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1941872 - 2065
NM_001754 (RUNX1)194565 - 758
NM_001001890 (RUNX1)1941872 - 2065
Exon 6 To Exon 7 (Pair 3)
Forward (3650,21)AGATGGCACTCTGGTCACTGTAmplicon SizecDNA: 185 bpgenomic: 21,163
Reverse (3834,20)CGACTTGCGGTGGGTTTGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.258 kcal/mol
Forward Dimers-1.447 kcal/mol
Reverse Loops1.066 kcal/mol
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers-0.926 kcal/mol
Amplicon Folding-2.396 kcal/mol outside primersite
Amplicon SequenceAGATGGCACTCTGGTCACTGTGATGGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAG
AAATGCTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGG
TCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCA
AGTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1851872 - 2056
NM_001754 (RUNX1)185565 - 749
NM_001001890 (RUNX1)1851872 - 2056
Exon 6 To Exon 7 (Pair 4)
Forward (3699,21)GCTGAGCTGAGAAATGCTACCAmplicon SizecDNA: 123 bpgenomic: 21,101
Reverse (3821,22)GTTTGTGAAGACAGTGATGGTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.541 kcal/mol in 3' area
Forward Dimers-2.84 kcal/mol
Reverse Loops0.628 kcal/mol in 3' area
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.532 kcal/mol
Amplicon Folding-1.416 kcal/mol outside primersite
Amplicon SequenceGCTGAGCTGAGAAATGCTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTC
AGGTTTGTCGGTCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACA
AAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001754 (RUNX1)123614 - 736
NM_001122607 (RUNX1)1231921 - 2043
NM_001001890 (RUNX1)1231921 - 2043
Exon 6 To Exon 7 (Pair 5)
Forward (3699,21)GCTGAGCTGAGAAATGCTACCAmplicon SizecDNA: 124 bpgenomic: 21,102
Reverse (3822,22)GGTTTGTGAAGACAGTGATGGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.541 kcal/mol in 3' area
Forward Dimers-2.84 kcal/mol
Reverse Loops0.628 kcal/mol in 3' area
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.532 kcal/mol
Amplicon Folding-1.416 kcal/mol outside primersite
Amplicon SequenceGCTGAGCTGAGAAATGCTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTC
AGGTTTGTCGGTCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACA
AACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1241921 - 2044
NM_001754 (RUNX1)124614 - 737
NM_001001890 (RUNX1)1241921 - 2044
Exon 6 To Exon 7 (Pair 6)
Forward (3650,21)AGATGGCACTCTGGTCACTGTAmplicon SizecDNA: 186 bpgenomic: 21,164
Reverse (3835,20)GCGACTTGCGGTGGGTTTGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.258 kcal/mol
Forward Dimers-1.447 kcal/mol
Reverse Loops0.9 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.926 kcal/mol
Amplicon Folding-2.396 kcal/mol outside primersite
Amplicon SequenceAGATGGCACTCTGGTCACTGTGATGGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAG
AAATGCTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGG
TCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCA
AGTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1861872 - 2057
NM_001122607 (RUNX1)1861872 - 2057
NM_001754 (RUNX1)186565 - 750
Exon 7 To Exon 8 (Pair 1)
Forward (3807,21)ACTGTCTTCACAAACCCACCGAmplicon SizecDNA: 156 bpgenomic: 25,028
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol
Forward Dimers-0.486 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.281 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTG
GATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGG
AGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001754 (RUNX1)156722 - 877
NM_001122607 (RUNX1)1562029 - 2184
NM_001001890 (RUNX1)1562029 - 2184
Exon 7 To Exon 8 (Pair 2)
Forward (3822,19)CCACCGCAAGTCGCCACCTAmplicon SizecDNA: 141 bpgenomic: 25,013
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.891 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAA
CCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCC
GAGCGGCTCAGTGAACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1412044 - 2184
NM_001754 (RUNX1)141737 - 877
NM_001001890 (RUNX1)1412044 - 2184
Exon 7 To Exon 8 (Pair 3)
Forward (3804,22)ATCACTGTCTTCACAAACCCACAmplicon SizecDNA: 159 bpgenomic: 25,031
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACA
GTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCC
GGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001754 (RUNX1)159719 - 877
NM_001122607 (RUNX1)1592026 - 2184
NM_001001890 (RUNX1)1592026 - 2184
Exon 7 To Exon 8 (Pair 4)
Forward (3820,19)ACCCACCGCAAGTCGCCACAmplicon SizecDNA: 145 bpgenomic: 25,017
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.891 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAG
AACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTT
CCGAGCGGCTCAGTGAACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1452042 - 2186
NM_001122607 (RUNX1)1452042 - 2186
NM_001754 (RUNX1)145735 - 879
Exon 7 To Exon 8 (Pair 5)
Forward (3801,22)ACCATCACTGTCTTCACAAACCAmplicon SizecDNA: 162 bpgenomic: 25,034
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol in 3' area
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATC
ACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAG
CCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1622023 - 2184
NM_001754 (RUNX1)162716 - 877
NM_001122607 (RUNX1)1622023 - 2184
Exon 7 To Exon 8 (Pair 6)
Forward (3806,21)CACTGTCTTCACAAACCCACCAmplicon SizecDNA: 157 bpgenomic: 25,029
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGT
GGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGG
GAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1572028 - 2184
NM_001122607 (RUNX1)1572028 - 2184
NM_001754 (RUNX1)157721 - 877
Exon 7 To Exon 8 (Pair 7)
Forward (3795,22)ACTCTGACCATCACTGTCTTCAAmplicon SizecDNA: 168 bpgenomic: 25,040
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATC
AAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAG
ACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1682017 - 2184
NM_001754 (RUNX1)168710 - 877
NM_001122607 (RUNX1)1682017 - 2184
Exon 7 To Exon 8 (Pair 8)
Forward (3834,20)GCCACCTACCACAGAGCCATAmplicon SizecDNA: 131 bpgenomic: 25,003
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.532 kcal/mol
Forward Dimers-0.251 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACAT
CGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGT
GAACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1312056 - 2186
NM_001754 (RUNX1)131749 - 879
NM_001122607 (RUNX1)1312056 - 2186
Exon 7 To Exon 8 (Pair 9)
Forward (3800,22)GACCATCACTGTCTTCACAAACAmplicon SizecDNA: 163 bpgenomic: 25,035
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol in 3' area
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAAT
CACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAA
GCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1632022 - 2184
NM_001754 (RUNX1)163715 - 877
NM_001001890 (RUNX1)1632022 - 2184
Exon 7 To Exon 8 (Pair 10)
Forward (3835,20)CCACCTACCACAGAGCCATCAmplicon SizecDNA: 130 bpgenomic: 25,002
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.532 kcal/mol
Forward Dimers-0.251 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATC
GGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTG
AACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1302057 - 2186
NM_001754 (RUNX1)130750 - 879
NM_001122607 (RUNX1)1302057 - 2186
Exon 7 To Exon 8 (Pair 11)
Forward (3798,22)CTGACCATCACTGTCTTCACAAAmplicon SizecDNA: 167 bpgenomic: 25,039
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol in 3' area
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAA
ATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACC
AAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1672020 - 2186
NM_001122607 (RUNX1)1672020 - 2186
NM_001754 (RUNX1)167713 - 879
Exon 7 To Exon 8 (Pair 12)
Forward (3835,20)CCACCTACCACAGAGCCATCAmplicon SizecDNA: 128 bpgenomic: 25,000
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.532 kcal/mol
Forward Dimers-0.251 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATC
GGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTG
AACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1282057 - 2184
NM_001122607 (RUNX1)1282057 - 2184
NM_001754 (RUNX1)128750 - 877
Exon 7 To Exon 8 (Pair 13)
Forward (3803,22)CATCACTGTCTTCACAAACCCAAmplicon SizecDNA: 162 bpgenomic: 25,034
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCAC
AGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCC
CGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001754 (RUNX1)162718 - 879
NM_001122607 (RUNX1)1622025 - 2186
NM_001001890 (RUNX1)1622025 - 2186
Exon 7 To Exon 8 (Pair 14)
Forward (3836,21)CACCTACCACAGAGCCATCAAAmplicon SizecDNA: 127 bpgenomic: 24,999
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.532 kcal/mol
Forward Dimers-0.251 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCG
GCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGA
ACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1272058 - 2184
NM_001754 (RUNX1)127751 - 877
NM_001122607 (RUNX1)1272058 - 2184
Exon 7 To Exon 8 (Pair 15)
Forward (3801,22)ACCATCACTGTCTTCACAAACCAmplicon SizecDNA: 164 bpgenomic: 25,036
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol in 3' area
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATC
ACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAG
CCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1642023 - 2186
NM_001122607 (RUNX1)1642023 - 2186
NM_001754 (RUNX1)164716 - 879
Exon 7 To Exon 8 (Pair 16)
Forward (3825,19)CCGCAAGTCGCCACCTACCAmplicon SizecDNA: 140 bpgenomic: 25,012
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.032 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceCCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCT
CGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAG
CGGCTCAGTGAACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001754 (RUNX1)140740 - 879
NM_001122607 (RUNX1)1402047 - 2186
NM_001001890 (RUNX1)1402047 - 2186
Exon 7 To Exon 8 (Pair 17)
Forward (3807,21)ACTGTCTTCACAAACCCACCGAmplicon SizecDNA: 158 bpgenomic: 25,030
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol
Forward Dimers-0.486 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.281 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTG
GATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGG
AGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1582029 - 2186
NM_001754 (RUNX1)158722 - 879
NM_001001890 (RUNX1)1582029 - 2186
Exon 7 To Exon 8 (Pair 18)
Forward (3795,22)ACTCTGACCATCACTGTCTTCAAmplicon SizecDNA: 170 bpgenomic: 25,042
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATC
AAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAG
ACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1702017 - 2186
NM_001122607 (RUNX1)1702017 - 2186
NM_001754 (RUNX1)170710 - 879
Exon 7 To Exon 8 (Pair 19)
Forward (3809,21)TGTCTTCACAAACCCACCGCAAmplicon SizecDNA: 156 bpgenomic: 25,028
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol
Forward Dimers-0.486 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-0.84 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGA
TGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAG
CTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1562031 - 2186
NM_001122607 (RUNX1)1562031 - 2186
NM_001754 (RUNX1)156724 - 879
Exon 7 To Exon 8 (Pair 20)
Forward (3797,22)TCTGACCATCACTGTCTTCACAAmplicon SizecDNA: 168 bpgenomic: 25,040
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.708 kcal/mol in 3' area
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAA
AATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGAC
CAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1682019 - 2186
NM_001754 (RUNX1)168712 - 879
NM_001001890 (RUNX1)1682019 - 2186
Exon 7 To Exon 8 (Pair 21)
Forward (3800,22)GACCATCACTGTCTTCACAAACAmplicon SizecDNA: 165 bpgenomic: 25,037
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol in 3' area
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAAT
CACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAA
GCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1652022 - 2186
NM_001754 (RUNX1)165715 - 879
NM_001122607 (RUNX1)1652022 - 2186
Exon 7 To Exon 8 (Pair 22)
Forward (3803,22)CATCACTGTCTTCACAAACCCAAmplicon SizecDNA: 160 bpgenomic: 25,032
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCAC
AGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCC
CGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1602025 - 2184
NM_001754 (RUNX1)160718 - 877
NM_001001890 (RUNX1)1602025 - 2184
Exon 7 To Exon 8 (Pair 23)
Forward (3806,21)CACTGTCTTCACAAACCCACCAmplicon SizecDNA: 159 bpgenomic: 25,031
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGT
GGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGG
GAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1592028 - 2186
NM_001122607 (RUNX1)1592028 - 2186
NM_001754 (RUNX1)159721 - 879
Exon 7 To Exon 8 (Pair 24)
Forward (3798,22)CTGACCATCACTGTCTTCACAAAmplicon SizecDNA: 165 bpgenomic: 25,037
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol in 3' area
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAA
ATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACC
AAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001754 (RUNX1)165713 - 877
NM_001122607 (RUNX1)1652020 - 2184
NM_001001890 (RUNX1)1652020 - 2184
Exon 7 To Exon 8 (Pair 25)
Forward (3809,21)TGTCTTCACAAACCCACCGCAAmplicon SizecDNA: 154 bpgenomic: 25,026
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol
Forward Dimers-0.486 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-0.84 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGA
TGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAG
CTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1542031 - 2184
NM_001122607 (RUNX1)1542031 - 2184
NM_001754 (RUNX1)154724 - 877
Exon 7 To Exon 8 (Pair 26)
Forward (3818,20)AAACCCACCGCAAGTCGCCAAmplicon SizecDNA: 145 bpgenomic: 25,017
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.891 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCG
AGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTT
TTCCGAGCGGCTCAGTGAACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1452040 - 2184
NM_001754 (RUNX1)145733 - 877
NM_001122607 (RUNX1)1452040 - 2184
Exon 7 To Exon 8 (Pair 27)
Forward (3834,20)GCCACCTACCACAGAGCCATAmplicon SizecDNA: 129 bpgenomic: 25,001
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.532 kcal/mol
Forward Dimers-0.251 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACAT
CGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGT
GAACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001754 (RUNX1)129749 - 877
NM_001122607 (RUNX1)1292056 - 2184
NM_001001890 (RUNX1)1292056 - 2184
Exon 7 To Exon 8 (Pair 28)
Forward (3797,22)TCTGACCATCACTGTCTTCACAAmplicon SizecDNA: 166 bpgenomic: 25,038
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.708 kcal/mol in 3' area
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAA
AATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGAC
CAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1662019 - 2184
NM_001122607 (RUNX1)1662019 - 2184
NM_001754 (RUNX1)166712 - 877
Exon 7 To Exon 8 (Pair 29)
Forward (3804,22)ATCACTGTCTTCACAAACCCACAmplicon SizecDNA: 161 bpgenomic: 25,033
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.638 kcal/mol
Forward Dimers-0.826 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.755 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACA
GTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCC
GGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1612026 - 2186
NM_001754 (RUNX1)161719 - 879
NM_001001890 (RUNX1)1612026 - 2186
Exon 7 To Exon 8 (Pair 30)
Forward (3820,19)ACCCACCGCAAGTCGCCACAmplicon SizecDNA: 143 bpgenomic: 25,015
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.891 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAG
AACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTT
CCGAGCGGCTCAGTGAACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1432042 - 2184
NM_001754 (RUNX1)143735 - 877
NM_001122607 (RUNX1)1432042 - 2184
Exon 7 To Exon 8 (Pair 31)
Forward (3825,19)CCGCAAGTCGCCACCTACCAmplicon SizecDNA: 138 bpgenomic: 25,010
Reverse (3962,20)CTCCAGTTCACTGAGCCGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.032 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceCCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCT
CGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAG
CGGCTCAGTGAACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1382047 - 2184
NM_001754 (RUNX1)138740 - 877
NM_001001890 (RUNX1)1382047 - 2184
Exon 7 To Exon 8 (Pair 32)
Forward (3818,20)AAACCCACCGCAAGTCGCCAAmplicon SizecDNA: 147 bpgenomic: 25,019
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.891 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCG
AGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTT
TTCCGAGCGGCTCAGTGAACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001754 (RUNX1)147733 - 879
NM_001122607 (RUNX1)1472040 - 2186
NM_001001890 (RUNX1)1472040 - 2186
Exon 7 To Exon 8 (Pair 33)
Forward (3836,21)CACCTACCACAGAGCCATCAAAmplicon SizecDNA: 129 bpgenomic: 25,001
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.532 kcal/mol
Forward Dimers-0.251 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCG
GCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGA
ACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1292058 - 2186
NM_001754 (RUNX1)129751 - 879
NM_001122607 (RUNX1)1292058 - 2186
Exon 7 To Exon 8 (Pair 34)
Forward (3822,19)CCACCGCAAGTCGCCACCTAmplicon SizecDNA: 143 bpgenomic: 25,015
Reverse (3964,20)TGCTCCAGTTCACTGAGCCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.891 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.471 kcal/mol
Reverse Dimers-2.079 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-0.695 kcal/mol outside primersite
Amplicon SequenceCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAA
CCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCC
GAGCGGCTCAGTGAACTGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001890 (RUNX1)1432044 - 2186
NM_001754 (RUNX1)143737 - 879
NM_001122607 (RUNX1)1432044 - 2186
Exon 8 To Exon 9 (Pair 1)
Forward (4031,20)CCTGAACCACTCCACTGCCTAmplicon SizecDNA: 286 bpgenomic: 12,999
Reverse (4316,24)TCCCATGTGTTAGGAACTATTATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.108 kcal/mol
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.225 kcal/mol
Reverse Dimers-0.561 kcal/mol
Forward-Reverse Dimers-1.549 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACAC
AGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAG
GATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGCCCT
CAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCTTCTC
CCCCTCTGCAAACCGTCGTAACAATAATAGTTCCTAACACATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)2862253 - 2538
Exon 8 To Exon 9 (Pair 2)
Forward (4029,20)TCCCTGAACCACTCCACTGCAmplicon SizecDNA: 98 bpgenomic: 12,811
Reverse (4126,23)AAGAACTGACTTCTGCCTTAACANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.108 kcal/mol
Forward Dimers0.374 kcal/mol in 3' area
Reverse Loops0.376 kcal/mol
Reverse Dimers-0.713 kcal/mol
Forward-Reverse Dimers-1.176 kcal/mol
Amplicon Folding0.064 kcal/mol inside primersite
Amplicon SequenceTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGAC
ACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)982251 - 2348
Exon 8 To Exon 9 (Pair 3)
Forward (4040,21)CTCCACTGCCTTTAACCCTCAAmplicon SizecDNA: 89 bpgenomic: 12,802
Reverse (4128,23)AGAAGAACTGACTTCTGCCTTAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops3.179 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops0.376 kcal/mol
Reverse Dimers-2.008 kcal/mol
Forward-Reverse Dimers-1.307 kcal/mol
Amplicon Folding0.064 kcal/mol inside primersite
Amplicon SequenceCTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCCTG
GAGATGTTAAGGCAGAAGTCAGTTCTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)892262 - 2350
Exon 8 To Exon 9 (Pair 4)
Forward (4019,19)CCCTCGTGCCTCCCTGAACAmplicon SizecDNA: 349 bpgenomic: 13,062
Reverse (4367,22)GCTGTGCATCAAGTGATTTCTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.644 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.683 kcal/mol in 3' area
Reverse Dimers-1.154 kcal/mol
Forward-Reverse Dimers-0.927 kcal/mol
Amplicon Folding-2.519 kcal/mol outside primersite
Amplicon SequenceCCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCA
GGAGGAAGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCT
CTCCCCAGCCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAA
GATGACAGCCCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCC
GTGTCCCTTCTCCCCCTCTGCAAACCGTCGTAACAATAATAGTTCCTAACACATGGGACA
ATTGTGAGGATTAAATGAGTTAGCCTGCAGAAATCACTTGATGCACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3492241 - 2589
Exon 8 To Exon 9 (Pair 5)
Forward (4032,21)CTGAACCACTCCACTGCCTTTAmplicon SizecDNA: 336 bpgenomic: 13,049
Reverse (4367,22)GCTGTGCATCAAGTGATTTCTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.108 kcal/mol
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.683 kcal/mol in 3' area
Reverse Dimers-1.154 kcal/mol
Forward-Reverse Dimers-2.609 kcal/mol
Amplicon Folding-2.519 kcal/mol outside primersite
Amplicon SequenceCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACA
GCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGG
ATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGCCCTC
AGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCTTCTCC
CCCTCTGCAAACCGTCGTAACAATAATAGTTCCTAACACATGGGACAATTGTGAGGATTA
AATGAGTTAGCCTGCAGAAATCACTTGATGCACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3362254 - 2589
Exon 8 To Exon 9 (Pair 6)
Forward (3986,19)GGTCAGCCCACACCACCCAAmplicon SizecDNA: 331 bpgenomic: 13,044
Reverse (4316,24)TCCCATGTGTTAGGAACTATTATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.324 kcal/mol
Forward Dimers-1.185 kcal/mol
Reverse Loops0.225 kcal/mol
Reverse Dimers-0.561 kcal/mol
Forward-Reverse Dimers-2.032 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceGGTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCAC
TGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCCTGGAGATG
TTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAGAGCTATCTTT
TCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGCCCTCAGAATGCACGTTAT
GAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCTTCTCCCCCTCTGCAAACCG
TCGTAACAATAATAGTTCCTAACACATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3312208 - 2538
Exon 8 To Exon 9 (Pair 7)
Forward (4025,20)TGCCTCCCTGAACCACTCCAAmplicon SizecDNA: 274 bpgenomic: 12,987
Reverse (4298,23)ATTATTGTTACGACGGTTTGCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.108 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.283 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.221 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGA
AGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCC
AGCCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGAC
AGCCCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCC
CTTCTCCCCCTCTGCAAACCGTCGTAACAATAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)2742247 - 2520
Exon 8 To Exon 9 (Pair 8)
Forward (3987,19)GTCAGCCCACACCACCCAGAmplicon SizecDNA: 132 bpgenomic: 12,845
Reverse (4118,22)ACTTCTGCCTTAACATCTCCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.816 kcal/mol
Forward Dimers0.022 kcal/mol
Reverse Loops2.432 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.579 kcal/mol
Amplicon Folding0.064 kcal/mol inside primersite
Amplicon SequenceGTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCACT
GCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCCTGGAGATGT
TAAGGCAGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1322209 - 2340
Exon 8 To Exon 9 (Pair 9)
Forward (4027,20)CCTCCCTGAACCACTCCACTAmplicon SizecDNA: 93 bpgenomic: 12,806
Reverse (4119,22)GACTTCTGCCTTAACATCTCCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.108 kcal/mol
Forward Dimers0.509 kcal/mol in 3' area
Reverse Loops2.437 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.256 kcal/mol
Amplicon Folding0.064 kcal/mol inside primersite
Amplicon SequenceCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAG
ACACAGCACCCTGGAGATGTTAAGGCAGAAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)932249 - 2341
Exon 8 To Exon 9 (Pair 10)
Forward (4040,21)CTCCACTGCCTTTAACCCTCAAmplicon SizecDNA: 216 bpgenomic: 12,929
Reverse (4255,22)GGAATTACAGACCCACATTCTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops3.179 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops1.46 kcal/mol in 3' area
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceCTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCCTG
GAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAGAGCT
ATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGCCCTCAGAATGCA
CGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)2162262 - 2477
Exon 8 To Exon 9 (Pair 11)
Forward (3986,19)GGTCAGCCCACACCACCCAAmplicon SizecDNA: 143 bpgenomic: 12,856
Reverse (4128,23)AGAAGAACTGACTTCTGCCTTAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.324 kcal/mol
Forward Dimers-1.185 kcal/mol
Reverse Loops0.376 kcal/mol
Reverse Dimers-2.008 kcal/mol
Forward-Reverse Dimers-2.368 kcal/mol
Amplicon Folding0.064 kcal/mol inside primersite
Amplicon SequenceGGTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCAC
TGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCCTGGAGATG
TTAAGGCAGAAGTCAGTTCTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1432208 - 2350
Exon 8 To Exon 9 (Pair 12)
Forward (4040,21)CTCCACTGCCTTTAACCCTCAAmplicon SizecDNA: 161 bpgenomic: 12,874
Reverse (4200,23)TCTTTCTTCTGAGTCTCTTCTGANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops3.179 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops1.739 kcal/mol
Reverse Dimers0.052 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.626 kcal/mol outside primersite
Amplicon SequenceCTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCCTG
GAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAGAGCT
ATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1612262 - 2422
Exon 8 To Exon 9 (Pair 13)
Forward (4028,20)CTCCCTGAACCACTCCACTGAmplicon SizecDNA: 174 bpgenomic: 12,887
Reverse (4201,23)ATCTTTCTTCTGAGTCTCTTCTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.108 kcal/mol
Forward Dimers0.509 kcal/mol in 3' area
Reverse Loops1.739 kcal/mol in 3' area
Reverse Dimers0.052 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-0.626 kcal/mol outside primersite
Amplicon SequenceCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGA
CACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGC
CAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1742250 - 2423
Exon 8 To Exon 9 (Pair 14)
Forward (4036,21)ACCACTCCACTGCCTTTAACCAmplicon SizecDNA: 76 bpgenomic: 12,789
Reverse (4111,21)CCTTAACATCTCCAGGGTGCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.813 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops1.567 kcal/mol in 3' area
Reverse Dimers-0.794 kcal/mol
Forward-Reverse Dimers-1.627 kcal/mol
Amplicon Folding0.173 kcal/mol outside primersite
Amplicon SequenceACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCAC
CCTGGAGATGTTAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)762258 - 2333
Exon 8 To Exon 9 (Pair 15)
Forward (4038,21)CACTCCACTGCCTTTAACCCTAmplicon SizecDNA: 330 bpgenomic: 13,043
Reverse (4367,22)GCTGTGCATCAAGTGATTTCTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops3.024 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops0.683 kcal/mol in 3' area
Reverse Dimers-1.154 kcal/mol
Forward-Reverse Dimers-2.497 kcal/mol
Amplicon Folding-2.519 kcal/mol outside primersite
Amplicon SequenceCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCC
TGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAGAG
CTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGCCCTCAGAATG
CACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCTTCTCCCCCTCT
GCAAACCGTCGTAACAATAATAGTTCCTAACACATGGGACAATTGTGAGGATTAAATGAG
TTAGCCTGCAGAAATCACTTGATGCACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3302260 - 2589
Exon 8 To Exon 9 (Pair 16)
Forward (3987,19)GTCAGCCCACACCACCCAGAmplicon SizecDNA: 328 bpgenomic: 13,041
Reverse (4314,24)CCATGTGTTAGGAACTATTATTGTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.816 kcal/mol
Forward Dimers0.022 kcal/mol
Reverse Loops0.225 kcal/mol
Reverse Dimers-0.35 kcal/mol
Forward-Reverse Dimers-2.032 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceGTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCACT
GCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCCTGGAGATGT
TAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAGAGCTATCTTTT
CCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGCCCTCAGAATGCACGTTATG
AGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCTTCTCCCCCTCTGCAAACCGT
CGTAACAATAATAGTTCCTAACACATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3282209 - 2536
Exon 8 To Exon 9 (Pair 17)
Forward (4038,21)CACTCCACTGCCTTTAACCCTAmplicon SizecDNA: 218 bpgenomic: 12,931
Reverse (4255,22)GGAATTACAGACCCACATTCTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops3.024 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops1.46 kcal/mol in 3' area
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCC
TGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAGAG
CTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGCCCTCAGAATG
CACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)2182260 - 2477
Exon 8 To Exon 9 (Pair 18)
Forward (4027,20)CCTCCCTGAACCACTCCACTAmplicon SizecDNA: 284 bpgenomic: 12,997
Reverse (4310,24)GTGTTAGGAACTATTATTGTTACGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.108 kcal/mol
Forward Dimers0.509 kcal/mol in 3' area
Reverse Loops0.225 kcal/mol
Reverse Dimers-0.312 kcal/mol
Forward-Reverse Dimers-1.76 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAG
ACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAG
CCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAG
CCCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCT
TCTCCCCCTCTGCAAACCGTCGTAACAATAATAGTTCCTAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)2842249 - 2532
Exon 8 To Exon 9 (Pair 19)
Forward (4027,20)CCTCCCTGAACCACTCCACTAmplicon SizecDNA: 269 bpgenomic: 12,982
Reverse (4295,22)ATTGTTACGACGGTTTGCAGAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.108 kcal/mol
Forward Dimers0.509 kcal/mol in 3' area
Reverse Loops1.283 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.221 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAG
ACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAG
CCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAG
CCCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCT
TCTCCCCCTCTGCAAACCGTCGTAACAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)2692249 - 2517
Exon 8 To Exon 9 (Pair 20)
Forward (4016,19)CAACCCTCGTGCCTCCCTGAmplicon SizecDNA: 299 bpgenomic: 13,012
Reverse (4314,24)CCATGTGTTAGGAACTATTATTGTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.399 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops0.225 kcal/mol
Reverse Dimers-0.35 kcal/mol
Forward-Reverse Dimers-2.035 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGAT
GCAGGAGGAAGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATC
CCTCTCCCCAGCCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAG
AAAGATGACAGCCCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCC
TCCGTGTCCCTTCTCCCCCTCTGCAAACCGTCGTAACAATAATAGTTCCTAACACATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)2992238 - 2536
Exon 8 To Exon 9 (Pair 21)
Forward (3987,19)GTCAGCCCACACCACCCAGAmplicon SizecDNA: 272 bpgenomic: 12,985
Reverse (4258,22)GGAGGAATTACAGACCCACATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.816 kcal/mol
Forward Dimers0.022 kcal/mol
Reverse Loops1.039 kcal/mol
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceGTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCACT
GCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCCTGGAGATGT
TAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAGAGCTATCTTTT
CCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGCCCTCAGAATGCACGTTATG
AGGAAGGCAGAATGTGGGTCTGTAATTCCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)2722209 - 2480
Exon 8 To Exon 9 (Pair 22)
Forward (4015,19)CCAACCCTCGTGCCTCCCTAmplicon SizecDNA: 379 bpgenomic: 13,092
Reverse (4393,24)ATAAATACACACAATGCTTCCCATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.399 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops1.184 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.896 kcal/mol
Amplicon Folding-2.519 kcal/mol outside primersite
Amplicon SequenceCCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGA
TGCAGGAGGAAGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCAT
CCCTCTCCCCAGCCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAA
GAAAGATGACAGCCCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTC
CTCCGTGTCCCTTCTCCCCCTCTGCAAACCGTCGTAACAATAATAGTTCCTAACACATGG
GACAATTGTGAGGATTAAATGAGTTAGCCTGCAGAAATCACTTGATGCACAGCACATGGG
AAGCATTGTGTGTATTTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3792237 - 2615
Exon 8 To Exon 9 (Pair 23)
Forward (4016,19)CAACCCTCGTGCCTCCCTGAmplicon SizecDNA: 295 bpgenomic: 13,008
Reverse (4310,24)GTGTTAGGAACTATTATTGTTACGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.399 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops0.225 kcal/mol
Reverse Dimers-0.312 kcal/mol
Forward-Reverse Dimers-2.035 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGAT
GCAGGAGGAAGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATC
CCTCTCCCCAGCCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAG
AAAGATGACAGCCCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCC
TCCGTGTCCCTTCTCCCCCTCTGCAAACCGTCGTAACAATAATAGTTCCTAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)2952238 - 2532
Exon 8 To Exon 9 (Pair 24)
Forward (3986,19)GGTCAGCCCACACCACCCAAmplicon SizecDNA: 388 bpgenomic: 13,101
Reverse (4373,21)CCATGTGCTGTGCATCAAGTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.324 kcal/mol
Forward Dimers-1.185 kcal/mol
Reverse Loops0.547 kcal/mol
Reverse Dimers-1.218 kcal/mol
Forward-Reverse Dimers-1.905 kcal/mol
Amplicon Folding-2.519 kcal/mol outside primersite
Amplicon SequenceGGTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCAC
TGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCCTGGAGATG
TTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAGAGCTATCTTT
TCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGCCCTCAGAATGCACGTTAT
GAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCTTCTCCCCCTCTGCAAACCG
TCGTAACAATAATAGTTCCTAACACATGGGACAATTGTGAGGATTAAATGAGTTAGCCTG
CAGAAATCACTTGATGCACAGCACATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3882208 - 2595
Exon 8 To Exon 9 (Pair 25)
Forward (4039,21)ACTCCACTGCCTTTAACCCTCAmplicon SizecDNA: 159 bpgenomic: 12,872
Reverse (4197,22)TTCTTCTGAGTCTCTTCTGAGGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops3.179 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops1.22 kcal/mol in 3' area
Reverse Dimers0.052 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-0.626 kcal/mol outside primersite
Amplicon SequenceACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCCT
GGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAGAGC
TATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1592261 - 2419
Exon 8 To Exon 9 (Pair 26)
Forward (3988,19)TCAGCCCACACCACCCAGCAmplicon SizecDNA: 308 bpgenomic: 13,021
Reverse (4295,22)ATTGTTACGACGGTTTGCAGAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol in 3' area
Forward Dimers0.022 kcal/mol
Reverse Loops1.283 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.687 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCACTG
CCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCCTGGAGATGTT
AAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAGAGCTATCTTTTC
CATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGCCCTCAGAATGCACGTTATGA
GGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCTTCTCCCCCTCTGCAAACCGTC
GTAACAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3082210 - 2517
Exon 8 To Exon 9 (Pair 27)
Forward (4039,21)ACTCCACTGCCTTTAACCCTCAmplicon SizecDNA: 217 bpgenomic: 12,930
Reverse (4255,22)GGAATTACAGACCCACATTCTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops3.179 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops1.46 kcal/mol in 3' area
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCCT
GGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAGAGC
TATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGCCCTCAGAATGC
ACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)2172261 - 2477
Exon 8 To Exon 9 (Pair 28)
Forward (4028,20)CTCCCTGAACCACTCCACTGAmplicon SizecDNA: 293 bpgenomic: 13,006
Reverse (4320,23)ATTGTCCCATGTGTTAGGAACTANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.108 kcal/mol
Forward Dimers0.509 kcal/mol in 3' area
Reverse Loops0.225 kcal/mol in 3' area
Reverse Dimers-0.561 kcal/mol
Forward-Reverse Dimers-1.76 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGA
CACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGC
CAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGC
CCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCTT
CTCCCCCTCTGCAAACCGTCGTAACAATAATAGTTCCTAACACATGGGACAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)2932250 - 2542
Exon 8 To Exon 9 (Pair 29)
Forward (4019,19)CCCTCGTGCCTCCCTGAACAmplicon SizecDNA: 107 bpgenomic: 12,820
Reverse (4125,23)AGAACTGACTTCTGCCTTAACATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.644 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.917 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.323 kcal/mol
Amplicon Folding0.064 kcal/mol inside primersite
Amplicon SequenceCCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCA
GGAGGAAGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1072241 - 2347
Exon 8 To Exon 9 (Pair 30)
Forward (4025,20)TGCCTCCCTGAACCACTCCAAmplicon SizecDNA: 295 bpgenomic: 13,008
Reverse (4319,23)TTGTCCCATGTGTTAGGAACTATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.108 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.225 kcal/mol in 3' area
Reverse Dimers-0.561 kcal/mol
Forward-Reverse Dimers-2.035 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGA
AGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCC
AGCCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGAC
AGCCCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCC
CTTCTCCCCCTCTGCAAACCGTCGTAACAATAATAGTTCCTAACACATGGGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)2952247 - 2541
Exon 8 To Exon 9 (Pair 31)
Forward (4022,20)TCGTGCCTCCCTGAACCACTAmplicon SizecDNA: 353 bpgenomic: 13,066
Reverse (4374,21)CCCATGTGCTGTGCATCAAGTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.303 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.547 kcal/mol
Reverse Dimers-1.218 kcal/mol
Forward-Reverse Dimers-0.927 kcal/mol
Amplicon Folding-2.519 kcal/mol outside primersite
Amplicon SequenceTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGA
GGAAGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTC
CCCAGCCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGAT
GACAGCCCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTG
TCCCTTCTCCCCCTCTGCAAACCGTCGTAACAATAATAGTTCCTAACACATGGGACAATT
GTGAGGATTAAATGAGTTAGCCTGCAGAAATCACTTGATGCACAGCACATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3532244 - 2596
Exon 8 To Exon 9 (Pair 32)
Forward (4016,19)CAACCCTCGTGCCTCCCTGAmplicon SizecDNA: 351 bpgenomic: 13,064
Reverse (4366,22)CTGTGCATCAAGTGATTTCTGCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.399 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops0.683 kcal/mol
Reverse Dimers-1.154 kcal/mol
Forward-Reverse Dimers-0.927 kcal/mol
Amplicon Folding-2.519 kcal/mol outside primersite
Amplicon SequenceCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGAT
GCAGGAGGAAGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATC
CCTCTCCCCAGCCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAG
AAAGATGACAGCCCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCC
TCCGTGTCCCTTCTCCCCCTCTGCAAACCGTCGTAACAATAATAGTTCCTAACACATGGG
ACAATTGTGAGGATTAAATGAGTTAGCCTGCAGAAATCACTTGATGCACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3512238 - 2588
Exon 8 To Exon 9 (Pair 33)
Forward (4031,20)CCTGAACCACTCCACTGCCTAmplicon SizecDNA: 95 bpgenomic: 12,808
Reverse (4125,23)AGAACTGACTTCTGCCTTAACATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.108 kcal/mol
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops0.917 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.635 kcal/mol
Amplicon Folding0.064 kcal/mol inside primersite
Amplicon SequenceCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACAC
AGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)952253 - 2347
Exon 8 To Exon 9 (Pair 34)
Forward (4028,20)CTCCCTGAACCACTCCACTGAmplicon SizecDNA: 355 bpgenomic: 13,068
Reverse (4382,21)CAATGCTTCCCATGTGCTGTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.108 kcal/mol
Forward Dimers0.509 kcal/mol in 3' area
Reverse Loops0.787 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-0.518 kcal/mol
Amplicon Folding-2.519 kcal/mol outside primersite
Amplicon SequenceCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGA
CACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGC
CAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGC
CCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCTT
CTCCCCCTCTGCAAACCGTCGTAACAATAATAGTTCCTAACACATGGGACAATTGTGAGG
ATTAAATGAGTTAGCCTGCAGAAATCACTTGATGCACAGCACATGGGAAGCATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3552250 - 2604
Exon 8 To Exon 9 (Pair 35)
Forward (4015,19)CCAACCCTCGTGCCTCCCTAmplicon SizecDNA: 114 bpgenomic: 12,827
Reverse (4128,23)AGAAGAACTGACTTCTGCCTTAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.399 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops0.376 kcal/mol
Reverse Dimers-2.008 kcal/mol
Forward-Reverse Dimers-0.844 kcal/mol
Amplicon Folding0.064 kcal/mol inside primersite
Amplicon SequenceCCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGA
TGCAGGAGGAAGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1142237 - 2350
Exon 8 To Exon 9 (Pair 36)
Forward (4019,19)CCCTCGTGCCTCCCTGAACAmplicon SizecDNA: 355 bpgenomic: 13,068
Reverse (4373,21)CCATGTGCTGTGCATCAAGTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.644 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.547 kcal/mol
Reverse Dimers-1.218 kcal/mol
Forward-Reverse Dimers-0.927 kcal/mol
Amplicon Folding-2.519 kcal/mol outside primersite
Amplicon SequenceCCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCA
GGAGGAAGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCT
CTCCCCAGCCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAA
GATGACAGCCCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCC
GTGTCCCTTCTCCCCCTCTGCAAACCGTCGTAACAATAATAGTTCCTAACACATGGGACA
ATTGTGAGGATTAAATGAGTTAGCCTGCAGAAATCACTTGATGCACAGCACATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3552241 - 2595
Exon 8 To Exon 9 (Pair 37)
Forward (3987,19)GTCAGCCCACACCACCCAGAmplicon SizecDNA: 311 bpgenomic: 13,024
Reverse (4297,23)TTATTGTTACGACGGTTTGCAGANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.816 kcal/mol
Forward Dimers0.022 kcal/mol
Reverse Loops1.283 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.687 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceGTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCACT
GCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCCTGGAGATGT
TAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAGAGCTATCTTTT
CCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGCCCTCAGAATGCACGTTATG
AGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCTTCTCCCCCTCTGCAAACCGT
CGTAACAATAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3112209 - 2519
Exon 8 To Exon 9 (Pair 38)
Forward (4036,21)ACCACTCCACTGCCTTTAACCAmplicon SizecDNA: 162 bpgenomic: 12,875
Reverse (4197,22)TTCTTCTGAGTCTCTTCTGAGGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.813 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops1.22 kcal/mol in 3' area
Reverse Dimers0.052 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-0.626 kcal/mol outside primersite
Amplicon SequenceACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCAC
CCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAG
AGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1622258 - 2419
Exon 8 To Exon 9 (Pair 39)
Forward (4017,20)AACCCTCGTGCCTCCCTGAAAmplicon SizecDNA: 110 bpgenomic: 12,823
Reverse (4126,23)AAGAACTGACTTCTGCCTTAACANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.399 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops0.376 kcal/mol
Reverse Dimers-0.713 kcal/mol
Forward-Reverse Dimers-0.844 kcal/mol
Amplicon Folding0.064 kcal/mol inside primersite
Amplicon SequenceAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATG
CAGGAGGAAGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1102239 - 2348
Exon 8 To Exon 9 (Pair 40)
Forward (3988,19)TCAGCCCACACCACCCAGCAmplicon SizecDNA: 380 bpgenomic: 13,093
Reverse (4367,22)GCTGTGCATCAAGTGATTTCTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol in 3' area
Forward Dimers0.022 kcal/mol
Reverse Loops0.683 kcal/mol in 3' area
Reverse Dimers-1.154 kcal/mol
Forward-Reverse Dimers-1.635 kcal/mol
Amplicon Folding-2.519 kcal/mol outside primersite
Amplicon SequenceTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCACTG
CCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCCTGGAGATGTT
AAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAGAGCTATCTTTTC
CATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGCCCTCAGAATGCACGTTATGA
GGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCTTCTCCCCCTCTGCAAACCGTC
GTAACAATAATAGTTCCTAACACATGGGACAATTGTGAGGATTAAATGAGTTAGCCTGCA
GAAATCACTTGATGCACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3802210 - 2589
Exon 8 To Exon 9 (Pair 41)
Forward (4017,20)AACCCTCGTGCCTCCCTGAAAmplicon SizecDNA: 356 bpgenomic: 13,069
Reverse (4372,22)CATGTGCTGTGCATCAAGTGATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.399 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops0.547 kcal/mol
Reverse Dimers-1.218 kcal/mol
Forward-Reverse Dimers-0.927 kcal/mol
Amplicon Folding-2.519 kcal/mol outside primersite
Amplicon SequenceAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATG
CAGGAGGAAGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCC
CTCTCCCCAGCCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGA
AAGATGACAGCCCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCT
CCGTGTCCCTTCTCCCCCTCTGCAAACCGTCGTAACAATAATAGTTCCTAACACATGGGA
CAATTGTGAGGATTAAATGAGTTAGCCTGCAGAAATCACTTGATGCACAGCACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3562239 - 2594
Exon 8 To Exon 9 (Pair 42)
Forward (4015,19)CCAACCCTCGTGCCTCCCTAmplicon SizecDNA: 186 bpgenomic: 12,899
Reverse (4200,23)TCTTTCTTCTGAGTCTCTTCTGANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.399 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops1.739 kcal/mol
Reverse Dimers0.052 kcal/mol
Forward-Reverse Dimers-0.395 kcal/mol
Amplicon Folding-0.626 kcal/mol outside primersite
Amplicon SequenceCCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGA
TGCAGGAGGAAGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCAT
CCCTCTCCCCAGCCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAA
GAAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)1862237 - 2422
Exon 8 To Exon 9 (Pair 43)
Forward (4020,19)CCTCGTGCCTCCCTGAACCAmplicon SizecDNA: 274 bpgenomic: 12,987
Reverse (4293,21)TGTTACGACGGTTTGCAGAGGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.644 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.283 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAG
GAGGAAGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTC
TCCCCAGCCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAG
ATGACAGCCCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCG
TGTCCCTTCTCCCCCTCTGCAAACCGTCGTAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)2742242 - 2515
Exon 8 To Exon 9 (Pair 44)
Forward (4036,21)ACCACTCCACTGCCTTTAACCAmplicon SizecDNA: 283 bpgenomic: 12,996
Reverse (4318,23)TGTCCCATGTGTTAGGAACTATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.813 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops0.225 kcal/mol in 3' area
Reverse Dimers-0.561 kcal/mol
Forward-Reverse Dimers-2.032 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCAC
CCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAG
AGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGCCCTCAGAA
TGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCTTCTCCCCCT
CTGCAAACCGTCGTAACAATAATAGTTCCTAACACATGGGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)2832258 - 2540
Exon 8 To Exon 9 (Pair 45)
Forward (4019,19)CCCTCGTGCCTCCCTGAACAmplicon SizecDNA: 376 bpgenomic: 13,089
Reverse (4394,24)AATAAATACACACAATGCTTCCCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.644 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.896 kcal/mol
Amplicon Folding-2.519 kcal/mol outside primersite
Amplicon SequenceCCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCA
GGAGGAAGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCT
CTCCCCAGCCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAA
GATGACAGCCCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCC
GTGTCCCTTCTCCCCCTCTGCAAACCGTCGTAACAATAATAGTTCCTAACACATGGGACA
ATTGTGAGGATTAAATGAGTTAGCCTGCAGAAATCACTTGATGCACAGCACATGGGAAGC
ATTGTGTGTATTTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3762241 - 2616
Exon 8 To Exon 9 (Pair 46)
Forward (3986,19)GGTCAGCCCACACCACCCAAmplicon SizecDNA: 325 bpgenomic: 13,038
Reverse (4310,24)GTGTTAGGAACTATTATTGTTACGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.324 kcal/mol
Forward Dimers-1.185 kcal/mol
Reverse Loops0.225 kcal/mol
Reverse Dimers-0.312 kcal/mol
Forward-Reverse Dimers-1.762 kcal/mol
Amplicon Folding-2.052 kcal/mol outside primersite
Amplicon SequenceGGTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCAC
TGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGAGGAAGACACAGCACCCTGGAGATG
TTAAGGCAGAAGTCAGTTCTTCTGTCCATCCCTCTCCCCAGCCAGGATAGAGCTATCTTT
TCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAGCCCTCAGAATGCACGTTAT
GAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCTTCTCCCCCTCTGCAAACCG
TCGTAACAATAATAGTTCCTAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001122607 (RUNX1)3252208 - 2532
 

See below for some more details.

Program Output:

Loading ...