Design Results for CLIP2

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 13 To Exon 14 (Pair 1)
Forward (2987,19)AGACCCATGACGCCTCGGGAmplicon SizecDNA: 98 bpgenomic: 7,912
Reverse (3084,19)GGCCTCCAGCAGCAACACCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.685 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops0.515 kcal/mol
Reverse Dimers-2.068 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding-1.496 kcal/mol outside primersite
Amplicon SequenceAGACCCATGACGCCTCGGGCCAGCTAGTCCTCATCAGCCAGGAGCTGCTGCGGAAGGAGC
GGAGCCTGAACGAACTGCGGGTGTTGCTGCTGGAGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003388 (CLIP2)982987 - 3084
NM_032421 (CLIP2)982882 - 2979
Exon 13 To Exon 14 (Pair 2)
Forward (2987,19)AGACCCATGACGCCTCGGGAmplicon SizecDNA: 106 bpgenomic: 7,920
Reverse (3092,20)TGACGATTGGCCTCCAGCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.685 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops0.515 kcal/mol in 3' area
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.518 kcal/mol
Amplicon Folding-1.496 kcal/mol outside primersite
Amplicon SequenceAGACCCATGACGCCTCGGGCCAGCTAGTCCTCATCAGCCAGGAGCTGCTGCGGAAGGAGC
GGAGCCTGAACGAACTGCGGGTGTTGCTGCTGGAGGCCAATCGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003388 (CLIP2)1062987 - 3092
NM_032421 (CLIP2)1062882 - 2987
Exon 13 To Exon 14 (Pair 3)
Forward (2987,19)AGACCCATGACGCCTCGGGAmplicon SizecDNA: 100 bpgenomic: 7,914
Reverse (3086,20)TTGGCCTCCAGCAGCAACACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.685 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops0.515 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.473 kcal/mol
Amplicon Folding-1.496 kcal/mol outside primersite
Amplicon SequenceAGACCCATGACGCCTCGGGCCAGCTAGTCCTCATCAGCCAGGAGCTGCTGCGGAAGGAGC
GGAGCCTGAACGAACTGCGGGTGTTGCTGCTGGAGGCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003388 (CLIP2)1002987 - 3086
NM_032421 (CLIP2)1002882 - 2981
Exon 13 To Exon 14 (Pair 4)
Forward (2987,19)AGACCCATGACGCCTCGGGAmplicon SizecDNA: 109 bpgenomic: 7,923
Reverse (3095,20)GAGTGACGATTGGCCTCCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.685 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops1.356 kcal/mol in 3' area
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.518 kcal/mol
Amplicon Folding-1.496 kcal/mol outside primersite
Amplicon SequenceAGACCCATGACGCCTCGGGCCAGCTAGTCCTCATCAGCCAGGAGCTGCTGCGGAAGGAGC
GGAGCCTGAACGAACTGCGGGTGTTGCTGCTGGAGGCCAATCGTCACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003388 (CLIP2)1092987 - 3095
NM_032421 (CLIP2)1092882 - 2990
Exon 13 To Exon 14 (Pair 5)
Forward (2987,19)AGACCCATGACGCCTCGGGAmplicon SizecDNA: 107 bpgenomic: 7,921
Reverse (3093,20)GTGACGATTGGCCTCCAGCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.685 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops0.515 kcal/mol in 3' area
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.518 kcal/mol
Amplicon Folding-1.496 kcal/mol outside primersite
Amplicon SequenceAGACCCATGACGCCTCGGGCCAGCTAGTCCTCATCAGCCAGGAGCTGCTGCGGAAGGAGC
GGAGCCTGAACGAACTGCGGGTGTTGCTGCTGGAGGCCAATCGTCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003388 (CLIP2)1072987 - 3093
NM_032421 (CLIP2)1072882 - 2988
Exon 13 To Exon 14 (Pair 6)
Forward (2987,19)AGACCCATGACGCCTCGGGAmplicon SizecDNA: 108 bpgenomic: 7,922
Reverse (3094,20)AGTGACGATTGGCCTCCAGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.685 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops0.937 kcal/mol in 3' area
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.518 kcal/mol
Amplicon Folding-1.496 kcal/mol outside primersite
Amplicon SequenceAGACCCATGACGCCTCGGGCCAGCTAGTCCTCATCAGCCAGGAGCTGCTGCGGAAGGAGC
GGAGCCTGAACGAACTGCGGGTGTTGCTGCTGGAGGCCAATCGTCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003388 (CLIP2)1082987 - 3094
NM_032421 (CLIP2)1082882 - 2989
Exon 13 To Exon 14 (Pair 7)
Forward (2987,19)AGACCCATGACGCCTCGGGAmplicon SizecDNA: 102 bpgenomic: 7,916
Reverse (3088,20)GATTGGCCTCCAGCAGCAACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.685 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops0.515 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.473 kcal/mol
Amplicon Folding-1.496 kcal/mol outside primersite
Amplicon SequenceAGACCCATGACGCCTCGGGCCAGCTAGTCCTCATCAGCCAGGAGCTGCTGCGGAAGGAGC
GGAGCCTGAACGAACTGCGGGTGTTGCTGCTGGAGGCCAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003388 (CLIP2)1022987 - 3088
NM_032421 (CLIP2)1022882 - 2983
Exon 13 To Exon 14 (Pair 8)
Forward (2987,19)AGACCCATGACGCCTCGGGAmplicon SizecDNA: 104 bpgenomic: 7,918
Reverse (3090,20)ACGATTGGCCTCCAGCAGCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.685 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops0.515 kcal/mol in 3' area
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.518 kcal/mol
Amplicon Folding-1.496 kcal/mol outside primersite
Amplicon SequenceAGACCCATGACGCCTCGGGCCAGCTAGTCCTCATCAGCCAGGAGCTGCTGCGGAAGGAGC
GGAGCCTGAACGAACTGCGGGTGTTGCTGCTGGAGGCCAATCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003388 (CLIP2)1042987 - 3090
NM_032421 (CLIP2)1042882 - 2985
Exon 13 To Exon 14 (Pair 9)
Forward (2987,19)AGACCCATGACGCCTCGGGAmplicon SizecDNA: 103 bpgenomic: 7,917
Reverse (3089,20)CGATTGGCCTCCAGCAGCAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.685 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops0.515 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.473 kcal/mol
Amplicon Folding-1.496 kcal/mol outside primersite
Amplicon SequenceAGACCCATGACGCCTCGGGCCAGCTAGTCCTCATCAGCCAGGAGCTGCTGCGGAAGGAGC
GGAGCCTGAACGAACTGCGGGTGTTGCTGCTGGAGGCCAATCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003388 (CLIP2)1032987 - 3089
NM_032421 (CLIP2)1032882 - 2984
 

See below for some more details.

Program Output:

Loading ...